| GLW77 |
C. elegans |
jnk-1(utx59[mNG::3xFlag::jnk-1]) IV. Show Description
N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.
|
|
| GLW8 |
C. elegans |
eel-1(utx8[mNG::eel-1]) IV. Show Description
Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'
|
|
| GLW95 |
C. elegans |
F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
|
|
| GT337 |
C. elegans |
aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| IG2212 |
C. elegans |
spia-1(fr201[spia-1::mNG(internal)::3xFLAG] X. Show Description
Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus.
|
|
| JDW389 |
C. elegans |
bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
|
|
| JDW390 |
C. elegans |
bli-2(wrd85[bli-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous bli-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW436 |
C. elegans |
nas-37(wrd106[nas-37:::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW460 |
C. elegans |
noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
|
|
| JDW461 |
C. elegans |
noah-2(wrd120[noah-2::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous noah-2 locus by CRISPR. Insertion produces a translational fusion after amino acid 388. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW478 |
C. elegans |
cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW650 |
C. elegans |
dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW651 |
C. elegans |
dpy-14(wrd229[dpy-14::mNG::3xFLAG]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW652 |
C. elegans |
rol-8(wrd230[rol-8mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous rol-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW653 |
C. elegans |
sqt-2(wrd231[sqt-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous sqt-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW654 |
C. elegans |
ram-2(wrd232[ram-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous ram-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW655 |
C. elegans |
cut-2(wrd233[cut-2::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cut-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW656 |
C. elegans |
npa-1(wrd234[npa-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous npa-1 locus by CRISPR. Allele obtained using Cas9 RNP. [NOTE: There is a deletion in the 3’ linker as after the 3’ FLAG tag there is the following sequence: AASSGSIRSIVDLQNA. This strain cannot be re-edited.]
|
|
| JDW699 |
C. elegans |
col-14(wrd271[col-14::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW708 |
C. elegans |
nas-37(wrd106 wrd251[nas-37::mScarlet::2xOLLAS]) X. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous nas-37 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd106.
|
|
| JDW733 |
C. elegans |
mlt-8(wrd278[mlt-8::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous mlt-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW734 |
C. elegans |
col-12(wrd279[col-12::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-12 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW735 |
C. elegans |
col-41(wrd280[col-41::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted 6 bp before the stop codon in the endogenous col-41 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW736 |
C. elegans |
clec-180(wrd281[clec-180::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous clec-180 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW737 |
C. elegans |
mlt-10(wrd282[mlt-10::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous mlt-10 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW739 |
C. elegans |
mlt-9(wrd284[mlt-9::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous mlt-9 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW740 |
C. elegans |
acn-1(wrd285[acn-1::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the first exon of the endogenous acn-1 locus by CRISPR. Will produce a linker::mNG::3xFLAG::linker fusion after the 32nd amino acid. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW741 |
C. elegans |
qua-1(wrd286[qua-1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous qua-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW742 |
C. elegans |
cpg-7(wrd287[cpg-7::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cpg-7 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW747 |
C. elegans |
bli-5(wrd292(bli-5::mNG::3xFLAG)) III. Show Description
mNeonGreen::3xFLAG tag inserted at the C-terminus of the endogenous bli-5 locus by CRISPR. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method.
|
|
| JDW758 |
C. elegans |
K10D3.4(wrd296[K10D3.4::mNG::3xFLAG]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous K10D3.4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW764 |
C. elegans |
col-125(wrd300[col-125::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-125 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW765 |
C. elegans |
col-103(wrd301[col-103::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-103 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW766 |
C. elegans |
piit-1(wrd302[piit-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous piit-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW767 |
C. elegans |
ctsa-1.1(wrd303[ctsa-1.1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW769 |
C. elegans |
lon-8(wrd305[lon-8::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous lon-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW778 |
C. elegans |
K10D3.4(wrd296 wrd310[K10D3.4::mScarlet::2xOLLAS]) I. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous K10D3.4 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd296.
|
|
| JDW780 |
C. elegans |
col-125(wrd300 wrd312[col-125::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.
|
|
| JDW781 |
C. elegans |
col-103(wrd301 wrd313[col-103::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-103 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd301.
|
|
| JDW782 |
C. elegans |
piit-1(wrd302 wrd314[piit-1::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous piit-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd302.
|
|
| JDW783 |
C. elegans |
ctsa-1.1(wrd303 wrd315[ctsa-1.1::mScarlet::2xOLLAS]) II. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd303.
|
|
| JDW785 |
C. elegans |
lon-8(wrd305 wrd317[lon-8::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous lon-8 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd305.
|
|
| JDW786 |
C. elegans |
srap-1(wrd318[srap-1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the first exon after the signal sequenceof the endogenous srap-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW788 |
C. elegans |
col-166(wrd319[col-166::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally to produce a translational fusion after amino acid 120 in the endogenous col-166 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW789 |
C. elegans |
lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW802 |
C. elegans |
dao-2(wrd328[dao-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dao-2 locus by CRISPR using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW818 |
C. elegans |
dpy-13(syb3318(wrd337[dpy-13::30x linker::mScarlet(dpi)::10x linker]) IV. Show Description
30x linker::mScarlet(dpi)::10x linker tag inserted into the C-terminus of the endogenous dpy-13 locus by CRISPR using a Cas9 RNP. Derived by modification of syb3318[dpy-13::mNG] in parental strain PHX3318, replacing mNeonGreen with the mScarlet and linkers.
|
|
| JDW820 |
C. elegans |
col-159(wrd339)[col-159::linker::mNG::3xFLAG::linker]) V Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-159 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW827 |
C. elegans |
col-118(wrd343[col-118::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-118 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW828 |
C. elegans |
col-13(wrd344[col-13::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-13 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|