Search Strains

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

C32D5.5 deletion allele.

jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.

jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.

jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2615 [loxP attP rps-7 3' FRT3] II. jsSi1784 [mex-5p::FLP D5::SL2::mNeonGreen::glh-2 3' UTR + Cbr-unc-119(+) attL rps-7 3' mex-5p::phiC31::glh-2 3' FRT3] IV. Expressses phiC31 and FLP recombinases and mNG in germline. Strain contains an unmarked phiC31 attP landing site on Chr II. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

wgIs386 [F21D5.9::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

(III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase driver expressed from the nmr-1 locus. nmr-1::SL2::FLP causes recombination in command interneurons including AVA, AVD, AVE, RIM, AVG, PVCs. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase driver expressed from the unc-4 locus. unc-4::SL2::FLP causes recombination specifically in Dorsal A-type motor neurons, SABs neurons and I5. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F01D5.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCCTTCTATGCTACGTCGCATGCCCACCCATCC. Right flanking sequence: CATCGGAAATCATCCGGAAATTGGCATTCCACCCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCATGCCCACCCATCCCAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.4. Homozygous. Outer Left Sequence: CCGATGAGCAGCTGTTGTTA. Outer Right Sequence: AAAGGGAAAATTGCAACGTG. Inner Left Sequence: ACGGTATGTCGTCCGATTTG. Inner Right Sequence: AGCAATGCGGAGACAGTTTT. Inner Primer PCR Length: 2218 bp. Deletion Size: 1180 bp. Deletion left flank: CCAAACTTCAATTGCCACTTAGATAAGAAT. Deletion right flank: TTTCTCAGAACTCAGAATATTAATCAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09D8.1 Homozygous. NOTE: C09D8.1 used to be ptp-1; ptp-1 is now C48D5.2. Outer Left Sequence: aaatccgttgagcaaacacc. Outer Right Sequence: gtccttctcgattttcagcg. Inner Left Sequence: ttttacggccaattttctgc. Inner Right Sequence: atatccttgtgcgcgtaacc. Inner Primer PCR Length: 2770. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.14 Homozygous. Outer Left Sequence: gctgcaatcaatttgggtct. Outer Right Sequence: tggatcgatcaacgtgatgt. Inner Left Sequence: atcgaggaaacacggtgaag. Inner Right Sequence: tgtgtgagccgaatctgaaa. Inner Primer PCR Length: 1283. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21D5.1. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 2044 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate adults (ve599 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatttttttcagaaATGGATCTCACTGTT ; Right flanking sequence: cataatctcccaaagttttttttaaatttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve668 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

Homozygous viable. Deletion of 2965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttcattccttgttcttctttgtcacaATG ; Right flanking sequence: CGGAAAATGAATAGgaattgttttctttct. sgRNA #1: CCACGTGGTGTACAGgttag; sgRNA #2: ACAATTGTCATCGAAGCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCCAGCTGCTCCTCTTCTTCTAGTGGAT ; Right flanking sequence: CGGTGGCTCGGTTCGCCGAAACATTTTTAT. F54D5.9 sgRNA #1: CATTGACGAGTTCAGCAGCT; F54D5.9 sgRNA #2: TTTCTAGCCAACAATCGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATCTTGTAAAGTTTTTCGTGTTCTTCCA ; Right flanking sequence: TGGAAAAATCAGACtttagttttttttAAT. F21D5.4 & F21D5.5 crRNA A: TTTCCGCCCGAAATTCGAAG; F21D5.4 & F21D5.5 crRNA B: TCATCAAATCGCCGTTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10845 [F21D5.9::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

stIs11788 [C53D5.4::H1-wCherry + unc-119(+)].

stIs11814 [W10D5.3a::H1-wCherry + unc-119(+)].

stIs11960 [W10D5.1::H1-wCherry + unc-119(+)].

Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.

This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1795 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGGGGGAACAATGAGGACT. External right primer: AACCTCATCGACGATTCTGG. Internal left primer: GGGAGAAGTGGTGGAACAAA. Internal right primer: TGTTATCGCTTTCGCTGTTG. Internal WT amplicon: 3104 bp. Deletion size: 1411 bp. Deletion left flank: AGATTCTCGGAAGATTCTGATTTTCTGGTC. Deletion right flank: TTCATTCCGTCTCCGAGAAGGTTCAGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W10D5.1. External left primer: CCCTGTTGGATCTCCTGAAA. External right primer: TCATCACACAACACACCACG. Internal left primer: AAGAAGGCAGGCTCGTGTAA. Internal right primer: CCACCTACTCCATACCGCAA. Internal WT amplicon: 1885 bp. Deletion size: 1075 bp. Deletion left flank: TATGAAAAATCATGGTAACCTCCAGAGATT. Deletion right flank: TAATTTTTATCAAAAAATTGTCAGAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.8, F54D5.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1925 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CTCTGGAAAGTTCCGCACTC. External right primer: TTTGGAGGGTGAGCTCAAGT. Internal left primer: TTCCATTTCTCCGTGTTTCC. Internal right primer: AGGTGATTGTTGCGGTTTTT. Internal WT amplicon: 2104 bp. Deletion size: 1109 bp. Deletion left flank: AGATGAAGATTACAAGAAAAGTTATGACGG. Deletion right flank: TTAATATTTAAGGCTGGTGTAGTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807