BC10336 |
C. elegans |
dpy-5(e907) I; sEx10336. Show Description
sEx10336 [rCes B0035.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10352 |
C. elegans |
dpy-5(e907) I; sEx10352. Show Description
sEx10352 [rCesB0035.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC11774 |
C. elegans |
dpy-5(e907) I; sEx11774. Show Description
sEx11774 [rCesB0035.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
DM7141 |
C. elegans |
pha-1(e2123) III; raEx141. Show Description
raEx141 [T05G5.1p::B0035.15(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
RG3240 |
C. elegans |
B0035.15(ve740[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 1324 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve740 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaactttaaaacttgtaacttcataagcaa ; Right flanking sequence: cggtacttctttaaaggtacagcacccgaa. sgRNA #1: aacaacttaaaatcgacccg; sgRNA #2: gatcgcaaaaattcggggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC1032 |
C. elegans |
pfd-4(gk430) IV. Show Description
B0035.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2582 |
C. elegans |
B0035.11(gk1081) IV/nT1 [qIs51] (IV;V). Show Description
B0035.11. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: TTCGGACATAGTGGTTCCGT. External right primer: TTACGTTCCCCAGTGTCTCC. Internal left primer: AGCGAGGAAGACGTAGTGGA. Internal right primer: TGCACCAGGAACACCAGTTA. Internal WT amplicon: 1795 bp. Deletion size: 710 bp. Deletion left flank: GGAAGGTCATACGATGTGTAAGAACAGCTT. Deletion right flank: CTTTCGGCTTTCCTTCTCTGTCGGAATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|