Search Strains

More Fields
Strain Species Genotype Add
VC1099 C. elegans hsp-4(gk514) II. Show Description
F43E2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1636 C. elegans rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2013 C. elegans snr-3&rsp-5(ok2084)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2272 C. elegans rsp-3(ok2927) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y111B2A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2927 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGGCTGATGAATACTTGGA. External right primer: CGTGGCACACTCATTTCTTG. Internal left primer: GGTTGTTTGAATTAAGGATAGGTGA. Internal right primer: TTGAAGGATTTTAGGCCCAG. Internal WT amplicon: 1226 bp. Deletion size: 632 bp. Deletion left flank: GTTTCAAAAATAGTAAAAACTCACCTCATG. Deletion right flank: ATTATTTGCAAAAAATCGGCGACTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2346 C. elegans hsp-12.3(ok3095) IV. Show Description
F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2754 C. elegans hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC281 C. elegans hsp-12.6(gk156) IV. Show Description
F38E11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3075 C. elegans tsp-3(ok3729) III. Show Description
Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3476 C. elegans hsp-1(ok1371) IV/nT1[qIs51] (IV;V). Show Description
F26D10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1371 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCTCTCTCCCCCTTTTCGT. External right primer: AATAGCTTCTGCACCGCCTA. Internal left primer: GTTTTCATGCACGGAAAGGT. Internal right primer: CCTCAACCCCTGGCATAATA. Internal WT amplicon: 2566 bp. Deletion size: 1225 bp. Deletion left flank: ACGCAACGTTCTTATCTTCGATCTTGGAGG. Deletion right flank: CCTTCAACCTTAAGCAGACCATTGAGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC366 C. elegans tsp-12(ok239) IV. Show Description
T14G10.6 . Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3716 C. elegans hasp-2(gk3670[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1240 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTTTTAGAAAAATCGATCAGCCACGAAAAA; Right flanking sequence: ACCACTGCCGTCTTCGTGAACCGCATCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3724 C. elegans tasp-1(gk3684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 57 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCCTTCTGAAACATCGATTCAGTGGAG. Right flanking sequence: AGGTTTGCGCACACTAATTATCGATTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3764 C. elegans rsp-4(gk3722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4213 C. elegans tsp-19(gk5299) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.
VC4545 C. elegans nasp-2(gk5616[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2208 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATAGATTTAAAGTGAATGGTTGGCTGGTG. Right flanking sequence: GCGGGACGCGGAGCCAGGGAAAGTGGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4629 C. elegans msp-45(gk5698[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAATCAGAAAAGTTGAACTAAGGCCTTCT. Right flanking sequence: AGGTCATTTCACGTACAAATAGCTAGGGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC463 C. elegans rsp-2(ok639) II. Show Description
W02B12.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC475 C. elegans hsp-16.2(gk249) V. Show Description
Y46H3A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4754 C. elegans msp-64(gk5822[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTAATTCAAAGCCAGTGGAGAGTGTCGA. Right flanking sequence: TGGTCTTGACGTTTTTAATGAATTTTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC520 C. elegans isp-1(gk267) IV/nT1 [qIs51] (IV;V). Show Description
F42G8.12. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk267 homozygotes (mid-larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC597 C. elegans rsp-6(ok798) IV/nT1 [qIs51] (IV;V). Show Description
C33H5.12. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok798 homozygotes (Dpyish, slow-growing, sometimes sterile, some embryonic lethality, various morphological defects). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC633 C. elegans tsp-15(ok854) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F53B6.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok854 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC634 C. elegans tsp-15(ok881) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F53B6.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok881 homozygotes (larval arrest, lumpy body). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC914 C. elegans hsp-90(ok1333) V/nT1 [qIs51] (IV;V). Show Description
C47E8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1333 homozygotes (paralyzed Unc, mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Previously known as daf-21. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7060 C. elegans asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH715 C. elegans hdIs17 I; hdIs10 V; nre-1(hd20) lin-15B(hd126) X. Show Description
hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.
VH7154 C. elegans hsp-60 (hd7146 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VK737 C. elegans vkEx737. Show Description
vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VT733 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
VX80 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H2. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX81 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H3. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX82 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H4. Isolated from pill bug in a Chinese cabbage field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX83 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H5. Isolated from pill bug under roadside haystack, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX84 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H6. Isolated from pill bug under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX85 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H7. Isolated from soil under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX86 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H8. Isolated from pill bug in a vegetable field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX87 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H9. Isolated from soil in an eggplant field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX88 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H10. Isolated from soil near the lotus pond, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VZ454 C. elegans gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.
WH517 C. elegans ojIs40. Show Description
ojIs40 [pie-1::mGFP::wsp-1(G-protein binding domain) + unc-119(+)]. Reference: Kumfer et al. (2010) Mol Biol Cell (2):266-77.
WH527 C. elegans cgef-1(gk261) X; ojIs40. Show Description
ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal condition. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WH558 C. elegans chin-1(tm1909)/sC1 [dpy-1(s2170) let(gk597)] III; ojIs40. Show Description
ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WRM30 C. elegans sprSi20 II; unc-119(ed3) III. Show Description
sprSi20 [mex-5p::MODC PEST::GFP::H2B::usp-14 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM45 C. elegans mex-3(spr5[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 488 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM49 C. elegans mex-3(spr6[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr6) is a CRISPR/Cas9 engineered deletion removing 142 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM5 C. elegans sprSi5 II; unc-119(ed3) III. Show Description
sprSi5 [mex-5p::MODC PEST::GFP::H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM50 C. elegans mex-3(spr7[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr7) is a CRISPR/Cas9 engineered deletion removing 134 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM52 C. elegans mex-3(spr9[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp). Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM53 C. elegans mex-3(spr10[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 190 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.