Search Strains

smIs34 [ced-1p::ced-1::GFP + rol-6(su1006)]. Maintain under standard conditions. Reference: Zou W, et al., (2009) PLoS Genet. 5(10):e1000679.

968 bp deletion. Engulfment defects.

smIs10 [ced-3p::ced-3::GFP + rol-6(su1006)] I. Rollers. Reference: Geng X, et al. Nat Struct Mol Biol. 2008 Oct;15(10):1094-101.

Homozygous viable. Slow growth but not lethal or sterile. Reference: Breckenridge DG, et al. Mol Cell. 2008 Aug 22;31(4):586-97.

Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.

smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.

tm2443 is a 204 bp deletion + 7 bp insertion in 21762/21763-TTTTCTC-21966/21967. A low penetrance (1/25) of chromosome bridges is observed at anaphase I. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.

Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.

Heterozygotes are WT and GFP+. Segregate syp-3(ok758) homozygotes that are non-GFP and lay mostly dead eggs; these mutants lack synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

Heterozygotes are wild-type GFP+. Homozygotes (tm1791/tm1791) are 4% Him with 22% embryonic lethality. Maintain by picking GFP+. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.

Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP cra-1(tm2144) homozygotes (99.7% embryonic lethality, 61% larval lethality, Him). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2008) PLoS Genet 4(6):e1000088.

Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP syp-4(tm2713) homozygotes (viable but throw 97% dead eggs, 40% males). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2009) PLoS Genet 5(10):e1000669.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735.

siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055.

Derived by outcrossing RB785 three times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.

kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Defective in adaptation to a subset of AWC-sensed odorants. Dominant.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs53[odr-10::GFP]. Full length odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.

kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs104 [str-1p::GFP] X. AWB expression of GFP.

kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs121 [unc-115::GFP + lin-15(+)]; autosomal. Maintain under normal conditions. Reference: Lundquist E, et al. (1998) Neuron 21(2):385-92.

kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.

kyIs156 [str-1p::odr-10(cDNA)::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389).

kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.

kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.

slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.

Viable. Can be scored only using special neuronal markers such as zdIs5 [mec-4p::GFP + lin-15(+)], which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.

kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.

kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV.

Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array.

668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.