Search Strains

juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.

Superficially wild-type. Strong defects in axon regeneration. Maintain under normal conditions. Reference: Yan D, et al. Cell. 2009 Sep 4;138(5):1005-18.

vab-1 null phenotype. e2027 is a 74 bp deletion allele.

juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83.

Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.

Mild Unc and Egl. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.

juIs52 [vab-2::GFP + rol-6(su1006)]. Rescuing GFP-tagged VAB-2 transgene. Rollers. vab-2 formerly known as efn-1.

adIs1240 [eat-4::sGFP + lin-15(+)] X.

adIs1240 [eat-4::sGFP + lin-15(+)] X.

adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.

adEx1262 [gcy-5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1266 [gcy-12::GFP + lin-15(+)]. Maintain by picking non-Muv. Very weak GFP signal. n765 is temperature-sensitive.

adEx1267 [gcy-8::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1269 [odr-1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1276 [gcy-?::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1288 [gcy-7::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive.

adEx1292 [R01E6.1_8k::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1295 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1296 [gcy-32::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1297 [gcy-6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1299 [avr-15::GFP + rol-6(su1006)]. GFP expression in pharyngeal muscle and some extrapharyngeal neurons. Maintain by picking Rollers.

adEx1350 [kin-18::GFP + rol-6(su1006)]. Pick Rollers. Only about 10% transmission.

Reversion of sa26. Severely reduced R spikes, long pumps, short hold-backs.

adEx1519 [M03F4.3::GFP + lin-15(+)]. Putative serotonin receptor. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1616 [ser-4::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1641 [C09B7.1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1644 [K02F2.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1646 [T02E9.3::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1647 [dop-1(trans)::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1648 [F01E11.5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1649 [F14D12.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

Deletion of bp 1108-3194 of C31H5.3

adEx1750 [pmk-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. Nuclear GFP in anterior and posterior intestine. [NOTE: adEx1750 contains a F42G8.4::GFP reporter construct. This array had been previously described as carrying a pmk-1::GFP reporter; the description of the array was updated in CGC records ~2016. islo-1, pmk-3, pmk-2, and pmk-1 are in an operon. The order of genes was described in Berman et al. as [pmk-1(F42G8.4)->pmk-2(F42G8.3)->pmk-3(B0218.3)], but the official WormBase gene names were assigned in reverse order [pmk-1(B0218.3)->pmk-2(F42G8.3)->pmk-3(F42G8.4)]. See Berman K, et al. Mol Cell Biol Res Commun. 2001 Nov;4(6):337-44. PMID: 11703092 for additional information.]

Deletion of bp 433-1994 of K02F2.6.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1.

Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.

Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1.

Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers.

Bacteria. E. coli strain carrying an avr-15::GFP fusion plasmid. Amp-R. Sac I Pst I fragment from K10B8 fused to transmembrane GFP from TM-1. Biosafety Level: BSL-1.

adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.

adEx2149 [odr-3p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.

adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.

Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.

Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.

Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well.

Abnormal feeding. Falls asleep. Does not feed while asleep. Semidominant. Previously called eat-7.