Search Strains

T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC204.11. Homozygous. Outer Left Sequence: AATGAGAGAAGAGACGGCGA. Outer Right Sequence: CTGCTGAGCGTCCATTATGA. Inner Left Sequence: TTGGGATACACTGTAACAAAACC. Inner Right Sequence: CAAGAATCCTGTCTGACGCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 686 bp. Deletion left flank: ATCCGAAAGCTGTGGGAACTCGGCGCACGT. Deletion right flank: GCTGTAAATTTGCATGTTAATTTTGCTCAA. Insertion Sequence: TTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54C8.11. Homozygous. Outer Left Sequence: TCAAGCTGACAACGTTCCTG. Outer Right Sequence: CTTGTCCTTGCGTTGTCCTT. Inner Left Sequence: GGGTCCTGCCACTCAGACTA. Inner Right Sequence: CCGACACTACTTGAATAACCCC. Inner Primer PCR Length: 1138 bp. Deletion Size: 449 bp. Deletion left flank: TTTGTCACGTTTTTGCCATTGGTTTTGGTA. Deletion right flank: TTTGAGGTGATACAAAAAAACTGTCAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07A9.5. Homozygous. Outer Left Sequence: CCAAAGAACTTCCATCTGCC. Outer Right Sequence: TGCGGGTCATCACTAATCCT. Inner Left Sequence: TTTCGATAGGATGACGAAACG. Inner Right Sequence: GGGCTTTAACACAATTCTCCC. Inner Primer PCR Length: 1218 bp. Deletion Size: 811 bp. Deletion left flank: CCCGGAAAAAATGATTTTCTTGCGGGAAAA. Deletion right flank: TTTTCAGATTCGTCGGTTCTGGTTTCAGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C12D8.11. Homozygous. Outer Left Sequence: AAGGCCACAATCTGTTCTGC. Outer Right Sequence: GACAAGAAGCAACCCCAAAA. Inner Left Sequence: CTTGTCCGATCTTCCAATCC. Inner Right Sequence: ACACCATGAGCTGGTTCACA. Inner Primer PCR Length: 3130 bp. Deletion Size: 1172 bp. Deletion left flank: TAATCTGAGTAGGCATTGAGCATTGGACAT. Deletion right flank: GTTTTGCACACAGTAACTACTAAATTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12H6.11. Homozygous. Outer Left Sequence: CTCTAGGTCTTTTGCGCAGG. Outer Right Sequence: CAGTGAGATGTCGGCTGCTA. Inner Left Sequence: GGACTATAACTCGAGAACCGC. Inner Right Sequence: CGAAAACGGTTACTTTTCGAG. Inner Primer PCR Length: 1249 bp. Deletion Size: 759 bp. Deletion left flank: ACTCAGAATTTTATTTTAAACATTTTGTTA. Deletion right flank: TTGAATTTATTTTTTCAGAGTTTTCCAAGG. Insertion Sequence: AATTGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G1C.10. Homozygous. Outer Left Sequence: TCGCTACGCGATACTTTGTG. Outer Right Sequence: AACCCGGTGATTTAATGCAG. Inner Left Sequence: TTGTGCATTACGCATTTTCAG. Inner Right Sequence: TAAAGTTCTGGCGGAGGAAA. Inner Primer PCR Length: 1187 bp. Deletion Size: 575 bp. Deletion left flank: GAGAATCGGATAAAAATAATTTATTTAAGT. Deletion right flank: CCGAATAACGAGAAGCCGCATGTTATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W05G11.4. Homozygous. Outer Left Sequence: AAGTTGGCTTCCTCTCACCA. Outer Right Sequence: TGAGTAAAAATTTTCGGCGG. Inner Left Sequence: TTATATTCTGCGCAATCATCG. Inner Right Sequence: TGGAAAATATTTGGCTGGAAA. Inner Primer PCR Length: 3073 bp. Deletion Size: 1767 bp. Deletion left flank: CTCGTAAGAGGTGACATTGGAACACTTTCA. Deletion right flank: AGAAATCATCAACAATTATTACTTCCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.11 Homozygous. Outer Left Sequence: ttccgcattggaaaagattc. Outer Right Sequence: atgggatcactcttcggatg. Inner Left Sequence: aacaagaacgaggcgtcatc. Inner Right Sequence: ggaatggagccaagtgga. Inner Primer PCR Length: 1114. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.10 Homozygous. Outer Left Sequence: gcggtgaaaccgtcattact. Outer Right Sequence: actccacatccatcgaaagg. Inner Left Sequence: cttcggcttatccaaatcca. Inner Right Sequence: caaactccctcctcgtgtgt. Inner Primer PCR Length: 1105. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04D2.3 Homozygous. Outer Left Sequence: ttgtttgttccgtttggaca. Outer Right Sequence: tatgaaaaccgcaggaatgg. Inner Left Sequence: tttcgacccgaaacatttta. Inner Right Sequence: ggttttcacgcgttttagatg. Inner Primer PCR Length: 1205. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F2.3 Homozygous. Outer Left Sequence: ggtgaaggttcaggcttctg. Outer Right Sequence: gtgatcatctccaagtggca. Inner Left Sequence: ccgtatgttagtgcgagtagaa. Inner Right Sequence: ggagctgaacaaggtctcca. Inner Primer PCR Length: 1189. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12G11.3 Homozygous. Outer Left Sequence: aatggaccacttgaagtccg. Outer Right Sequence: atcaacgaatgaaagacggg. Inner Left Sequence: cagtcccatctccagctgat. Inner Right Sequence: cgatttttcaatgcgatgag. Inner Primer PCR Length: 1362. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: cggtacttgcaaagaaggct. Inner Primer PCR Length: 1193. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A4.7. Homozygous. Outer Left Sequence: AAGCTTGCGTCTTGAGAAGG. Outer Right Sequence: AAACTTGGCAATGTTGGAGG. Inner Left Sequence: GAGGAGATGATGAGTTCGGG. Inner Right Sequence: GGAATATACGTTGAGACGCCA. Inner Primer PCR Length: 1099 bp. Deletion Size: 432 bp. Deletion left flank: GGACACAAAGGAGAAGATATACCTGACGGT. Deletion right flank: CACATTGCCATCTTCATATGCTTCATCGGC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01H11.3 Homozygous. Outer Left Sequence: ccgattgccaaaacgattac. Outer Right Sequence: agcccgcttccttcatagtt. Inner Left Sequence: tcatgaagctatcggaagatca. Inner Right Sequence: tcctccatcaccagacaaca. Inner Primer PCR Length: 1194. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35D10.11 Homozygous. Outer Left Sequence: ttacatgggtgcaaatgtcg. Outer Right Sequence: ataccccaacataatgccca. Inner Left Sequence: ttcagcttctccgccactac. Inner Right Sequence: caactgaacacgtcattgtgg. Inner Primer PCR Length: 1257. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H22K11.2 Homozygous. Outer Left Sequence: cttggtggctcatcaggaat. Outer Right Sequence: gtaaagggcaccctgaacaa. Inner Left Sequence: ggaaagtaccggagcagtga. Inner Right Sequence: ttggcacgtttttaattttgg. Inner Primer PCR Length: 1266. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]

Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A6.11 Homozygous. Outer Left Sequence: tgtggctggtctgggttaat. Outer Right Sequence: ttttgcaccactgctttgag. Inner Left Sequence: aagggagaagaaaacccgac. Inner Right Sequence: atgttcaatccgtgctgtca. Inner Primer PCR Length: 1200. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07A11.4. Homozygous. Outer Left Sequence: GCAGACCGAGAAGAGAAGGA. Outer Right Sequence: CAAAAATTTCATCCGGCCTA. Inner Left Sequence: CAAGGAATGGATGCAAAAGG. Inner Right Sequence: TTTCCATGCTTCATTCGACA. Inner Primer PCR Length: 1095 bp. Deletion Size: 681 bp. Deletion left flank: ACGCGCAGACCGAGAAGAGAAGGATCGAGA. Deletion right flank: CAAGGCTACACTGGTCTCCGAAACATTGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D8.2 Homozygous. Outer Left Sequence: atggagcacgctcttgctat. Outer Right Sequence: tgggatctttccagagatgg. Inner Left Sequence: tcacatggaaaacgaggaca. Inner Right Sequence: gctcttggttgagaagacgg. Inner Primer PCR Length: 1222. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G11.4 Homozygous. Outer Left Sequence: caatgtccttcccaacatca. Outer Right Sequence: ttaatttttgaattcgcccg. Inner Left Sequence: caagattattatgctacaaactacacg. Inner Right Sequence: gttccagcatctctcctcgt. Inner Primer PCR Length: 1357. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B7.11 Homozygous. Outer Left Sequence: ttggtcggaaatggaaagag. Outer Right Sequence: tctccgaaatcaaatcgtcc. Inner Left Sequence: cagtggaatgaaggctttgg. Inner Right Sequence: ttgagactgttctctttcaaattca. Inner Primer PCR Length: 1197. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55B11.1 Homozygous. Outer Left Sequence: acttgcgcacaaacattcag. Outer Right Sequence: ccaaaaagtcaatgcagggt. Inner Left Sequence: gcattgtttcatcgtttcca. Inner Right Sequence: cagtttcacgcaattgatttt. Inner Primer PCR Length: 1211. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H1A.5 Homozygous. Outer Left Sequence: cgccgaaaatacggtatcac. Outer Right Sequence: tttcttctggaaaatgcgct. Inner Left Sequence: gggtctcgacacgaaaattg. Inner Right Sequence: gatcttgaatgcgtggtgtg. Inner Primer PCR Length: 1312. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C37H5.11 Homozygous. Outer Left Sequence: agattttgatgagcccgatg. Outer Right Sequence: acggagacgttttgtatggg. Inner Left Sequence: ctccgtttggctcatcagtt. Inner Right Sequence: atcctgccggattcattgta. Inner Primer PCR Length: 1127. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3.11 Homozygous. Outer Left Sequence: tgttttgccacgtcattgtt. Outer Right Sequence: aatatcagccacgccttcat. Inner Left Sequence: cattgcccttattcttccca. Inner Right Sequence: gcacaaaatcgttttgcttca. Inner Primer PCR Length: 1301. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3.11 Homozygous. Outer Left Sequence: tgttttgccacgtcattgtt. Outer Right Sequence: aatatcagccacgccttcat. Inner Left Sequence: cattgcccttattcttccca. Inner Right Sequence: gcacaaaatcgttttgcttca. Inner Primer PCR Length: 1301. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35E8.11 Homozygous. Outer Left Sequence: gaactgtccgaacttgtccc. Outer Right Sequence: tgctcgcgaattgaagtatg. Inner Left Sequence: tttctgcatgaaaatcgaga. Inner Right Sequence: aaaacgtaaaacaccacgtaaaa. Inner Primer PCR Length: 1210. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.11 Homozygous. Outer Left Sequence: gctgaaaattgctctcaccc. Outer Right Sequence: aactttttagctccgcctcc. Inner Left Sequence: catttgatagccgcctcaat. Inner Right Sequence: ttttctcaacacggtttctcaa. Inner Primer PCR Length: 1129. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E7.11 Homozygous. Outer Left Sequence: cacatatcagggcggaaatc. Outer Right Sequence: tccgtcgggtctgaaagtag. Inner Left Sequence: cgagatgaaccagagaaagttg. Inner Right Sequence: cgctttgaatcagaagactcc. Inner Primer PCR Length: 1238. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58H1.7 Homozygous. Outer Left Sequence: aaagagatggtcgcactcgt. Outer Right Sequence: gagggtttatgctcacgtcg. Inner Left Sequence: caatgcagatgtgaatgcaa. Inner Right Sequence: actcgcctccacgactttc. Inner Primer PCR Length: 1194. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807