Search Strains

D1054.1 Homozygous. Outer Left Sequence: ctcaggcagcaaactgttga. Outer Right Sequence: gcttacaatttcggagcagc. Inner Left Sequence: tgcatcactaatacccatctcg. Inner Right Sequence: ggtgcatctgcaggaagttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69H2.11 Homozygous. Outer Left Sequence: tttaggattttcgtggtggg. Outer Right Sequence: catgcgaagtcagtggagaa. Inner Left Sequence: tttggattcatgattggcct. Inner Right Sequence: ctgacaccacgtgccttcta. Inner Primer PCR Length: 1182. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30F12.2 Homozygous. Outer Left Sequence: cgagaactgaatcgtgggat. Outer Right Sequence: ccccaattcgctcaaaatta. Inner Left Sequence: tcattagctgcagattgtttgaa. Inner Right Sequence: tctgcaagttcaacggttttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0252.3 Homozygous. Outer Left Sequence: gcatgaacagcagtctggaa. Outer Right Sequence: ctgtttccttgggcttcttg. Inner Left Sequence: ggtgaaagcattcctccaaa. Inner Right Sequence: tctcatgttctgcatttccg. Inner Primer PCR Length: 1275. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK75.1 Homozygous. Outer Left Sequence: ccggtaccgacttggaacta. Outer Right Sequence: agaaagctgggtcgtgagac. Inner Left Sequence: caaaagcgttcactctagaaaat. Inner Right Sequence: aaaaagacaaccgtccctcc. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y22D7AL.8 Homozygous. Outer Left Sequence: aaaatcgataaatcgccacg. Outer Right Sequence: ttttcagcctttctcccaga. Inner Left Sequence: ttgtatttatcgattttcgcca. Inner Right Sequence: cagtaccccgaggaaattca. Inner Primer PCR Length: 1211. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK525.2 Homozygous. Outer Left Sequence: cagttttgcgtccgaatttt. Outer Right Sequence: aaaattgagcccacgacatc. Inner Left Sequence: atggaaatctcgggtcctct. Inner Right Sequence: gtgcctggtctccaacaaat. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E11.7 Homozygous. Outer Left Sequence: atcgggacccacaaactaca. Outer Right Sequence: gcaaacttttcggtgcaaac. Inner Left Sequence: gcttggtgatcaattgtttgg. Inner Right Sequence: tgttgagtcagtcggaatctg. Inner Primer PCR Length: 1209. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H2.5 Homozygous. Outer Left Sequence: cggatttcatgttcctgtca. Outer Right Sequence: tgaattccaaccctgaatcc. Inner Left Sequence: aaacacaaaaacaacaaagaattga. Inner Right Sequence: ttgttgcggaatttacatcg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27D6.11 Homozygous. Outer Left Sequence: aatccgtctgattggctcac. Outer Right Sequence: ctgaagagttgagcccgaag. Inner Left Sequence: ctgttgtggctatggattttg. Inner Right Sequence: tggctttcgaacgaagtctc. Inner Primer PCR Length: 1230. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.2 Homozygous. Outer Left Sequence: tcgtttcgagaccgagtacc. Outer Right Sequence: caccatttggagtgacgttg. Inner Left Sequence: tgggtccaaaattgccagt. Inner Right Sequence: atctatgagcgaatcgtcgg. Inner Primer PCR Length: 1231. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W01C8.6. Homozygous. Outer Left Sequence: CCATTGAATGTGCAACGAAC. Outer Right Sequence: ATGGATTAGCAGTCCATCGC. Inner Left Sequence: TCGAGTGACCTCAAACATGC. Inner Right Sequence: ATGCAAGCATACTGGGAAGG. Inner primer WT PCR product: 2850. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09B8.7. Homozygous. Outer Left Sequence: GAGGAATGGATGCGTAAGGA. Outer Right Sequence: AGCCAGAAGCAACCAAGAAA. Inner Left Sequence: CCGACCATCGATTTTCAACT. Inner Right Sequence: GGAAGCGTCAGAAAAACCAG. Inner primer WT PCR product: 3211. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08F11.14. Homozygous. Outer Left Sequence: CCATCTTCAAGCTTTGCCTC. Outer Right Sequence: CACATTCGTCACCTGAATGC. Inner Left Sequence: CCAAAGTTGAGCACGTGAGA. Inner Right Sequence: GTTGCAAGGACTGATGCAGA. Inner primer WT PCR product: 3374. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F8.7. Homozygous. Outer Left Sequence: GCCACACACCTAACCGACTT. Outer Right Sequence: CAAACCCACTTCCCATCCTA. Inner Left Sequence: TGGACGAGAAGCTGATGATG. Inner Right Sequence: GTGCTCTCCAATTGCTCTCC. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D6.11. Homozygous. Outer Left Sequence: GTCTCCGGATGAGCAAAGAG. Outer Right Sequence: CGCCTAGCAAATAGACCCAG. Inner Left Sequence: GGAAGAGTGAGTGCCTCTCG. Inner Right Sequence: GTACGAAGAATTTGCCCGAA. Inner primer WT PCR product: 2941. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.9. Homozygous. Outer Left Sequence: AATGGGGGTAATGTGTGCAT. Outer Right Sequence: GGTGCGGTTCAGTCAATTTT. Inner Left Sequence: CCAGGTGCAACTGATTGAGA. Inner Right Sequence: TGCTTCACATTGAGAGCGTT. Inner primer WT PCR product: 2342. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10E11.6. Homozygous. Outer Left Sequence: TTGAAACGCCGATATCATCA. Outer Right Sequence: AGCGATGTTGGAATAAACGC. Inner Left Sequence: CCCACATTCCAAATAAACCG. Inner Right Sequence: TTCGTAGTAGGCGCTGGATT. Inner primer WT PCR product: 2829. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E11.1. Homozygous. Outer Left Sequence: AAGGGATGCAGATGATGGAG. Outer Right Sequence: TGCAGGCCTTCAGAACTTTT. Inner Left Sequence: AACCGGGAAGGAGTTACGAT. Inner Right Sequence: TCATGGACTGTGGCAGTAGC. Inner primer WT PCR product: 2891. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H12.4. Homozygous. Outer Left Sequence: GTTTCGTCGACTTTGCATCA. Outer Right Sequence: GCACTACACCTTCCGAGAGC. Inner Left Sequence: CCGATAGGGTTGCTTGATGT. Inner Right Sequence: GGTGCAACCGAAAGTTTGTT. Inner primer WT PCR product: 2828. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03G11.8. Homozygous. Outer Left Sequence: GGAGTGAACACCAACCTCGT. Outer Right Sequence: TTTTTCGCACTTCTTGCCTT. Inner Left Sequence: AAAATTGCGTTCAACCAAGC. Inner Right Sequence: TAGCCTTCGGCGTTCTTTTA. Inner primer WT PCR product: 2398. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01D12.11. Homozygous. Outer Left Sequence: TTGCATCCGCCTGAAATAAT. Outer Right Sequence: TCCAGTTTTTGATATCCGGG. Inner Left Sequence: ACCGGTGTGATCTTGTCTCC. Inner Right Sequence: GTTAATGCGACGCCAAAAGT. Inner primer WT PCR product: 2758. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.11 Homozygous. Outer Left Sequence: GTCAATTCGCTCATTCGGTT. Outer Right Sequence: GGTCAAGAAACGGAAAACCA. Inner Left Sequence: TTTTGAGCATCATCTTCCCC. Inner Right Sequence: AGGTCAGATGCGGTTATTCG. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50H2.1 Homozygous. Outer Left Sequence: TTGCCCAGACAAAACATTCA. Outer Right Sequence: AATCCAATTGTGGCCGTAAA. Inner Left Sequence: TGTTCAGGGTTAAGTTCGGG. Inner Right Sequence: CCAAAGAACAGGGTTGGAAA. Inner Primer PCR Length: 3352. Estimated Deletion Size: about 2300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B7.1 Homozygous. Outer Left Sequence: AACAAGTTCCCAAAACTGCG. Outer Right Sequence: AATGAAGATCCTGTGTCGGG. Inner Left Sequence: TGCGTACTTTTACCTCGGCT. Inner Right Sequence: ATGTTGGTCGAACGGATAGC. Inner Primer PCR Length: 3211. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H11.5. Homozygous. Outer Left Sequence: AGCGATGGATTTCGATTGAC. Outer Right Sequence: AAGGCACATGCCTAAAATGC. Inner Left Sequence: CAATCGAGTTCATCCCAACC. Inner Right Sequence: TTCCCAAAATTTCTTCTGCG. Inner Primer WT PCR product: 2197. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01D12.11. Homozygous. Outer Left Sequence: CGGACGCTGGTACTTCTTCT. Outer Right Sequence: GGGTCCATGAAAGAACTGGA. Inner Left Sequence: CTGGGACACCAACTGGAACT. Inner Right Sequence: CCTATTACCCGTTCCCCAAT. Inner Primer WT PCR product: 3033. Deletion size: 1259 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 1004 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807