| OH18614 |
C. elegans |
hlh-13(ot1388) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18615 |
C. elegans |
hlh-15(ot1389) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18694 |
C. elegans |
col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18755 |
Pristionchus pacificus |
unc-30(ot5019) IV. Show Description
unc
|
|
| OH18779 |
Pristionchus pacificus |
unc-25(ot5020) III. Show Description
unc
|
|
| OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18840 |
C. elegans |
hlh-32(ot1347) IV. Show Description
CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH19034 |
C. elegans |
degt-1(ot1466) V. Show Description
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19205 |
C elegans |
golg-4(ot1509[mScarlet3::golg-4]) III. Show Description
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH1960 |
C. elegans |
pha-1(e2123) III; otEx1043. Show Description
otEx1043 [dop-1(prom2)::GFP + pha-1(+)].
|
|
| OH2000 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1076. Show Description
otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
| OH2024 |
C. elegans |
exc-4(rh133) I; otEx1000. Show Description
otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2042 |
C. elegans |
lin-49(ot78) dpy-20(?) IV; otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.
|
|
| OH2096 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1131. Show Description
otEx1131[unc-47::GFP + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
| OH2143 |
C. elegans |
otIs39 II; wrk-1(ok695) X. Show Description
otIs39 [unc-47(delta)::GFP + lin-15(+)].
|
|
| OH2204 |
C. elegans |
otEx1182. Show Description
otEx1182[gst-44p::gst-44::GFP + rol-6(dom)]. Maintain by picking Rollers.
|
|
| OH2211 |
C. elegans |
otEx1184. Show Description
otEx1184 [exl-1p::exl-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to lysosomal membranes in the intestine and to the Golgi apparatus in neurons and muscle.
|
|
| OH2246 |
C. elegans |
otIs107. Show Description
otIs107 [ser-2::GFP + lin-15(+)]. Not on LG X.
|
|
| OH2344 |
C. elegans |
eno-2(ot2) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2345 |
C. elegans |
eno-3(ot3) oxIs12 X. Show Description
Ectopic DVB outgrowth. oxIs12 [unc-47p::GFP + lin-15(+)].
|
|
| OH2346 |
C. elegans |
eno-6(ot6) V; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2347 |
C. elegans |
eno-11(ot40) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2382 |
C. elegans |
eno-7(ot7) IV; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2383 |
C. elegans |
eno-8(ot8) III; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
|
|
| OH2411 |
C. elegans |
pha-1(e2123) III; otEx233. Show Description
otEx233 [dop-1(prom1)::GFP + pha-1(+)].
|
|
| OH2475 |
C. elegans |
otIs157. Show Description
otIs157 [lim-6r::GFP + rol-6(su1006)].
|
|
| OH2638 |
C. elegans |
dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet.
|
|
| OH2639 |
C. elegans |
dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet.
|
|
| OH2672 |
C. elegans |
otEx1495. Show Description
otEx1495 [sul-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP expression in hypodermis and AVL.
|
|
| OH2724 |
C. elegans |
otIs133; otEx1545. Show Description
otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70.
|
|
| OH2862 |
C. elegans |
otEx731. Show Description
otEx731[lin-23::GFP + rol-6(su1006)]. lin-23prom::GFP transcriptional fusion.
|
|
| OH2984 |
C. elegans |
otEx1765. Show Description
otEx1765 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2985 |
C. elegans |
otEx1766. Show Description
otEx1766 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2987 |
C. elegans |
otEx1768. Show Description
otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2990 |
C. elegans |
otEx1771. Show Description
otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2996 |
C. elegans |
ntIs1; lsy-2(ot64) X; otEx1777. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx1777 [lsy-2::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH3112 |
C. elegans |
otIs159. Show Description
otIs159 [die-1::GFP + rol-6(su1006)]. GFP expressed in embryonic hypodermis and head neurons.
|
|
| OH3150 |
C. elegans |
otIs160; otIs151. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. otIs160 [lsy-6::GFP + coelomocyte::GFP]. Rollers.
|
|
| OH3191 |
C. elegans |
otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.
|
|
| OH3313 |
C. elegans |
oyIs14 V; otIs37 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs37 [unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
|
|
| OH3314 |
C. elegans |
oyIs14 V; otIs38 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs38 [unc-47(del)::GFP]. otIs38 is integrated juEx60 [(pCZ114) unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
|
|
