| OH1476 |
C. elegans |
lin-23(ot1) II; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic AVL outgrowth.
|
|
| OH1589 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx840. Show Description
otEx840 [lin-23::GFP + rol-6(su1006)]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
| OH2000 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1076. Show Description
otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
| OH2096 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1131. Show Description
otEx1131[unc-47::GFP + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
| OH11630 |
C. elegans |
lsy-27(ot108) II; ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER.
|
|
| OH160 |
C. elegans |
otIs76 mgIs18 IV; lon-2(e678) hst-6(ot17) X. Show Description
otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. Long, otherwise phenotypically WT. ttx-3p::GFP labels AIY interneurons. hst-6(ot17) suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot17) is closely linked to lon-2.
|
|
| OH16219 |
C. elegans |
ceh-44(ot1015[ceh-44::gfp]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.
|
|
| OH16224 |
C. elegans |
ceh-49(ot1016[ceh-49::gfp]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-49 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.
|
|
| OH16294 |
C. elegans |
nono-1(ot1018[nono-1::gfp::3xflag]) III. Show Description
Superficially wild-type.
|
|
| OH16335 |
C. elegans |
ceh-34(ot1014) V; otEx7476. Show Description
otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| OH16345 |
C. elegans |
ceh-37(ot1023[ceh-37::GFP::FLAG]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-37 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16376 |
C. elegans |
ceh-44(ot1028) III. Show Description
ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.
|
|
| OH16377 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs356 V; otDf1 X. Show Description
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.
|
|
| OH16380 |
C. elegans |
nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X. Show Description
Endogenous nlp-45 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16445 |
C. elegans |
cdh-1(ot1034) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-1 locus.
|
|
| OH16446 |
C. elegans |
cdh-3(ot1035) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-3 locus.
|
|
| OH16461 |
C. elegans |
ama-1(ot1037[gfp::ama-1]) IV. Show Description
Superficially wild-type.
|
|
| OH16463 |
C. elegans |
smo-1(ot1038[smo-1::gfp::3xflag]) I. Show Description
Superficially wild-type.
|
|
| OH16464 |
C. elegans |
fust-1(ot1039[fust-1::gfp::3xflag]) II. Show Description
Superficially wild-type.
|
|
| OH16482 |
C. elegans |
rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. Show Description
Superficially wild-type.
|
|
| OH16487 |
C. elegans |
ceh-76(ot1042[ceh-76::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-76 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16499 |
C. elegans |
nlp-45(ot1046) X. Show Description
Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16500 |
C. elegans |
nlp-45(ot1047) X. Show Description
Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16505 |
C. elegans |
ceh-89(ot1050[ceh-89::GFP]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-89 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16563 |
C. elegans |
ceh-45(ot1065) I. Show Description
ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| OH16564 |
C. elegans |
ceh-53(ot1066) IV. Show Description
ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
|
|
| OH16565 |
C. elegans |
ceh-79(ot1067) V. Show Description
ot1067 is an engineered deletion of the full ceh-79 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
|
|
| OH16704 |
C. elegans |
fox-1(ot1081[fox-1::gfp::3xflag]) X. Show Description
Superficially wild-type.
|
|
| OH16739 |
C. elegans |
casy-1(ot1082) II. Show Description
CRISPR/Cas9 engineered deletion of full casy-1 locus.
|
|
| OH16750 |
C. elegans |
cdh-8(ot1084) IV. Show Description
CRISPR/Cas9 engineered deletion of full cdh-8 locus.
|
|
| OH16772 |
C. elegans |
fmi-1(ot1090) V. Show Description
CRISPR/Cas9 engineered deletion of full fmi-1 locus.
|
|
| OH16773 |
C. elegans |
cdh-12(ot1091) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-12 locus.
|
|
| OH16774 |
C. elegans |
cdh-1(ot1092[cdh-1::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-1 locus.
|
|
| OH16775 |
C. elegans |
cdh-5(ot1093) IV. Show Description
CRISPR/Cas9 engineered deletion of full cdh-5 locus.
|
|
| OH16783 |
C. elegans |
cdh-9(ot1095[cdh-9::T2A::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-9 locus.
|
|
| OH16795 |
C. elegans |
otEx7677; nlp-45(ot1046) X. Show Description
otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16799 |
C. elegans |
otEx7681; nlp-45(ot1046) X. Show Description
otEx7681 [glr-3p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Overexpression of nlp-45 in the RIA neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16830 |
C. elegans |
cdh-8(ot1106[cdh-8::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-7 locus.
|
|
| OH16831 |
C. elegans |
npr-17(ot1101[npr-17::GFP]) IV. Show Description
Endogenous npr-17 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16837 |
C. elegans |
him-8(e1489) IV; nlp-45(ot1032[nlp-45::T2A::GFP::H2B]) X; otEx7578. Show Description
otEx7578 [rab-3p::fem-3::SL2::TagRFP + inx-6(prom18)::TagRFP]. Panneuronal overexpression of fem-3 causes panneuronal masculation. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16932 |
C. elegans |
casy-1(ot1108[casy-1::T2A::GFP::H2B]) II. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous casy-1 locus.
|
|
| OH17000 |
C. elegans |
cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus.
|
|
| OH17002 |
C. elegans |
cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus.
|
|
| OH17030 |
C. elegans |
cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus.
|
|
| OH17051 |
C. elegans |
ceh-48(ot1125[ceh-48::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-48 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17055 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otDf1 X; otIs790. Show Description
otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17058 |
C. elegans |
cdh-5(ot1127[cdh-5::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-5 locus.
|
|
| OH17241 |
C elegans |
unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| OH17513 |
C. elegans |
unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17514 |
C. elegans |
ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. Show Description
Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|