| OH16391 |
C. elegans |
otEx7501. Show Description
otEx7501 [pdfr-1::GFP::cla-1 + pdfr-1::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal I1 neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
|
|
| OH16395 |
C. elegans |
otEx7505. Show Description
otEx7505 [ceh-19p::GFP::cla-1 + ceh-19p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Presynaptic GFP::cla-1 reporter for pharyngeal MC neurons. Reference: Cook SJ, et al. J Comp Neural. 2020 Nov 1;528(16):2767-2784. doi: 10.1002/cne.24932. PMID: 32352566.
|
|
| OH16398 |
C. elegans |
otIs763. Show Description
otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16461 |
C. elegans |
ama-1(ot1037[gfp::ama-1]) IV. Show Description
Superficially wild-type.
|
|
| OH16463 |
C. elegans |
smo-1(ot1038[smo-1::gfp::3xflag]) I. Show Description
Superficially wild-type.
|
|
| OH16464 |
C. elegans |
fust-1(ot1039[fust-1::gfp::3xflag]) II. Show Description
Superficially wild-type.
|
|
| OH16482 |
C. elegans |
rpc-1(ot1041[rpc-1::gfp::3xflag]) IV. Show Description
Superficially wild-type.
|
|
| OH16499 |
C. elegans |
nlp-45(ot1046) X. Show Description
Presumed null allele nlp-45. ot1046 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16500 |
C. elegans |
nlp-45(ot1047) X. Show Description
Presumed null allele nlp-45. ot1047 deletion causes a frameshift resulting in a shortened coding sequence that doesn't include mature neuropeptide. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16543 |
C. elegans |
unc-39(ok2137) V; otEx7581. Show Description
otEx7581 [unc-39(+) fosmid WRM0636cG07 + inx-6(prom18)::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH16563 |
C. elegans |
ceh-45(ot1065) I. Show Description
ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| OH1670 |
C. elegans |
him-5(e1490) V; otIs123. Show Description
otIs123 [sra-11::GFP + unc-4(+)]. Might contain an unc-4 mutation in the background.
|
|
| OH16704 |
C. elegans |
fox-1(ot1081[fox-1::gfp::3xflag]) X. Show Description
Superficially wild-type.
|
|
| OH16711 |
C. elegans |
pha-1(e2123) III; otEx7647. Show Description
otEx7647 [ttll-9p(500 bp)::GFP + pha-1(+)]. Maintain at 25C to retain array. OLQ neurons are marked with GFP. Can be used to isolate OLQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16719 |
C. elegans |
otIs138 X; otIs521. Show Description
otIs138 [ser-2(prom3) +rol-6(su1006)] X. otIs521 [eat-4(prom8)::tagRFP + ttx-3::GFP]. OLL neurons are labeled with GFP and RFP. Can be used to isolate OLL by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16737 |
C. elegans |
otIs788. Show Description
otIs788 [cat-4p::GFP::cla-1 + cat-4p::mCherry + inx-16p::tagRFP]. GFP-tagged CLA-1 provides a synaptic marker in HSN neurons. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH16738 |
C. elegans |
otIs789. Show Description
otIs789 [srg-8p::TagRFP + srg-8p::GFP::cla-1 + inx-6(prom18)::tagRFP]. ASKp::GFP::CLA-1(S) pre-synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH16749 |
C. elegans |
ynIs54 IV; hdIs32. Show Description
ynIs54 [flp-20p::GFP] IV. hdIs32 [glr-1::DsRed2]. PVC neurons are labeled with GFP and DsRed2. Can be used to isolate PVC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16816 |
C. elegans |
otIs809. Show Description
otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| OH16831 |
C. elegans |
npr-17(ot1101[npr-17::GFP]) IV. Show Description
Endogenous npr-17 locus tagged with GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| OH16848 |
C. elegans |
him-5(e1490)V; otIs518; otIs773. Show Description
otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
|
|
| OH16917 |
C. elegans |
pha-1(e2123) III; otEx7693. Show Description
otEx7693 [F23H12.7p(RIM)::tagRFP + pha-1(+)]. Maintain at 25C to retain array. RIM neurons marked with RFP. Can be used to isolate RIM by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16940 |
C. elegans |
ceh-20(ok541) III; otIs643 V; muEx261. Show Description
otIs643 [npr-9::TagRFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers.
|
|
| OH16949 |
C. elegans |
otIs736; evIs111. Show Description
otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16952 |
C. elegans |
pha-1(e2123) III; otEx7568. Show Description
otEx7568 [nlp-17::GFP + pha-1(+)]. Maintain at 25C to retain array. PVQ neurons marked with GFP. Can be used to isolate PVQ by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH16971 |
C. elegans |
otIs816. Show Description
otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17019 |
C. elegans |
otIs825. Show Description
otIs825 [degl-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17072 |
C. elegans |
otIs833. Show Description
otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH171 |
C. elegans |
otEx103. Show Description
otEx103[lim-7::GFP; rol-6(su1006)]. <50% penetrant Roller line. Maintain by picking Rollers. GFP strongly expressed in gonad sheath cell pair 1.
|
|
| OH17124 |
C. elegans |
otIs837. Show Description
otIs837 [unc-25(prom3)(del1)::GFP]. RME neurons are labeled with GFP. Can be used to isolate RME by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17211 |
C. elegans |
pha-1(e2123) III; otEx7567. Show Description
otEx7567[nlp-56p::GFP + pha-1(+)]. RMG neurons are labeled with GFP. Can be used to isolate RMG by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17217 |
C. elegans |
otIs846. Show Description
otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17225 |
C. elegans |
otEx7760. Show Description
otEx7760 [cat-4p::mCherry + zig-3p::mCherry + zig-3p::NLG1::GFP1-10 + cat-4p::NLG1::GFP11 + inx-6(prom18)::TagRFP]. BDU-HSN GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH17241 |
C elegans |
unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| OH17368 |
C. elegans |
otIs854. Show Description
otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17489 |
C. elegans |
egIs1 IV; otIs860. Show Description
egIs1 [dat-1p::GFP]; reportedly maps to LG IV. otIs860 [flp-33p::tagRFP]. CEP neurons are marked with bright green expression (dat-1p::GFP), and can be sorted by selecting the brightest GFP. there are other cells in which the GFP marker shows up, but expression is faint. Other fluorescing neurons (ADE and PDE) will be double positive (GFP and tagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH17492 |
C. elegans |
him-5(e1490) V; otEx7809. Show Description
otEx7809 [flp-7p::TagRFP + inx-1::tagRFP + flp-7p::NLG1::GFP1-10 + inx-1p::NLG1::GFP11]. Him. AIB-SAA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH17502 |
C. elegans |
otIs867. Show Description
otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| OH17726 |
Pristionchus pacificus |
unc-3(ot5008) X. Show Description
severe unc
|
|
| OH17751 |
C. elegans |
otEx7895. Show Description
otEx7895 [nmr-1p::CyoFP + flp-3p::mNeptune + gcy-35p::mNeptune flp-7p::tagRFP + klp-6::tagRFP + C42D4.1::GFP]. Pick animals with red or green fluorescence to maintain. AxoPAL strain for visualizing axonal neighborhoods. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.
|
|
| OH17874 |
C. briggsae |
Cbr-dpy-10(ot1210) II. Show Description
Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.
|
|
| OH18011 |
C. elegans |
pha-1(e2123) III; otEx7947. Show Description
otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH18012 |
C. elegans |
pha-1(e2123) III; otEx7948. Show Description
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
| OH18145 |
C. elegans |
otIs883. Show Description
otIs883 [srab-20p::GFP::cla-1 + unc-122p::mCherry]. Presynaptic GFP::cla-1 reporter for PHB neurons. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479.
|
|
| OH18190 |
Pristionchus pacificus |
unc-4(ot5018) II. Show Description
unc
|
|
| OH18424 |
C. elegans |
pha-1(e2123) III; otEx8047. Show Description
otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons.
|
|
| OH1849 |
C. elegans |
pha-1(e2123) III; otEx980. Show Description
otEx980 [dop-2::GFP + pha-1(+)].
|
|
| OH18501 |
C. elegans |
aex-1(ot1357) I. Show Description
ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18559 |
C. elegans |
him-5(e1490) V; otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1].
|
|
| OH18595 |
C. elegans |
unc-25(ot1372[unc-25::T2A::GFP::H2B] III. Show Description
Endogenous unc-25 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
