| CB4043 |
C. elegans |
smg-2(e2008) I; him-5(e1490) V. Show Description
e2008 recessively suppresses the phenotypes of mutations in unc-54(r293), lin-29(n546), tra-2 and dpy-5. Abnormal male tail. smg-2 homozygotes have slightly abnormal movement.
|
|
| CB406 |
C. elegans |
unc-57(e406) I. Show Description
Unc. Recessive. M-MATING++ 1-10%WT.
|
|
| CB4077 |
C. elegans |
eDf21/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT heterozygotes segregate WT, DpyUnc and unhatched eggs.
|
|
| CB444 |
C. elegans |
unc-52(e444) II. Show Description
Unc. Larvae move. Paralyzed adult. Dystrophic body muscle. M-MATING-NO SUCCESS. Recessive.
|
|
| CB4567 |
C. elegans |
unc-53(e2432) II. Show Description
Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration.
|
|
| CB4817 |
C. elegans |
wDf5(e500)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs.
|
|
| CB569 |
C. elegans |
unc-54(e569) I. Show Description
Paralyzed Unc.
|
|
| CB576 |
C. elegans |
unc-54(e576) I. Show Description
Slow movement.
|
|
| CB651 |
C. elegans |
unc-54(e651) I. Show Description
|
|
| CB665 |
C. elegans |
unc-58(e665) X. Show Description
Shaker Unc. Reverts spontaneously. M-MATING-NO SUCCESS.
|
|
| CB669 |
C. elegans |
unc-52(e669) II. Show Description
Unc-adults paralyzed. Dystrophic body muscle. Suppressed by sup-5 and sup-7. Null allele (?).
|
|
| CB675 |
C. elegans |
unc-54(e675) I. Show Description
Slow moving Unc. Semi-dominant.
|
|
| CB7080 |
C. elegans |
eEx754. Show Description
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
|
|
| CB7587 |
C. elegans |
ptr-15(gk5234) V; crEx498. Show Description
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3UTR + rps-27p::neoR::unc-54 3UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: ORourke et al. (in revision 2024).
|
|
| CB843 |
C. elegans |
unc-54(e843) I. Show Description
Stiff. Body muscle abnormal.
|
|
| CB998 |
C. elegans |
unc-52(e998) II. Show Description
Severe Unc. Paralyzed adults. Dystrophic body muscle.
|
|
| CD184 |
C. elegans |
ace-3(dc2) unc-52(e444) II. Show Description
Acetylcholine abnormal. Unc (phenotype exactly like unc-52 except lacking class C acetylcholinesterase).
|
|
| CD194 |
C. elegans |
lin-7(e1413) unc-52(e444) II. Show Description
Unc and Vul.
|
|
| CD196 |
C. elegans |
ace-3(dc2) unc-52(e444) egl-50(n1086) II. Show Description
Unc and Egl.
|
|
| CF4582 |
C. elegans |
muIs252 II; unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4586 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4587 |
C. elegans |
muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4588 |
C. elegans |
muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4592 |
C. elegans |
muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4594 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4601 |
C. elegans |
muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4608 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4610 |
C. elegans |
muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
|
|
| CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4614 |
C. elegans |
muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4616 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4625 |
C. elegans |
muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CGC105 |
C. elegans |
hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
|
|
| CGC43 |
C. elegans |
unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
|
|
| CGC48 |
C. elegans |
unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
|
|
| CGC58 |
C. elegans |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC59 |
C.elegans |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC72 |
C. elegans |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC73 |
C. elegans |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC81 |
C. elegans |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC94 |
C. elegans |
hIn1 [umnIs75] I. Show Description
umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
|
|
| CL2006 |
C. elegans |
dvIs2. Show Description
dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.
|
|
| CL2008 |
C. elegans |
him-5 (e1490) V; dvIs3. Show Description
dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.
|
|
| CL2120 |
C. elegans |
dvIs14. Show Description
dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.
|
|
| CL2122 |
C. elegans |
dvIs15. Show Description
dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Control strain for CL2120. Phenotype apparently WT.
|
|
| CY251 |
C. elegans |
sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
|
|
| CY262 |
C. elegans |
sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
|
|
| CY401 |
C. elegans |
sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.
|
|