Search Strains

Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.

Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Defective chemotaxis to NaCl. Defective osmotic avoidance. PKA ttx-4.

Reference: Nishio N, et al. Genes Cells. 2012 May;17(5):365-86.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.

Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.

Reference: Kodama E, et al. Genes Dev. 2006 Nov 1;20(21):2955-60.

Severe defects in thermotaxis.

Reference: Ohnishi N, et al. EMBO J. 2011 Apr 6;30(7):1376-88.

Reference: Ohnishi N, et al. EMBO J. 2011 Apr 6;30(7):1376-88.

nj53 is a SAX-7 long-form-specific deletion mutant. nj53 shos the normal neuronal position phenotype.

njIs10 [glr-3::GFP]. RIA interneurons express soluble GFP.

njIs11[glr-3p::GFP + ges-1p::RFP]. RIA interneurons express soluble GFP.

njIs12[glr-3p::glr-1::GFP + glr-3p::RFP + ges-1p::RFP]. RIA interneurons express soluble GFP.

njIs9 [glr-3p::snb-1::venus + ofm-1::GFP] IV.

Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.

Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.

Reference: Kimata T, et al. Genetics. 2012 Jun;191(2):509-21.

Reference: Nishio N, et al. Genes Cells. 2012 May;17(5):365-86.

edIs20 [F25B3.3::GFP + rol-6(su1006)]. Rollers. Pan-neuronal GFP expression. ur41 has longitudinal nerve defects.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. dapk-1(gk219) decreases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. pinn-1(tm2235) increases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::?Tn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (lacz?A::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.

Homozygous nhr-6(lg6001) mutants have defective spermatheca development causing low brood size, abnormally shaped eggs, and occasional Egl. Heterozygotes are WT and segregate WT, semi-sterile WT, and Sterile Dpys.

Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

egl-27(we3) animals have variable body morphology defects with cold sensitive embryonic/L1 lethality (5% die at 22C, 90% at 15C). Maternal effect vab-7(ed6) enhancer; semi-lethal with vab-7(ed6).

weIs11[unc-119(+) + TAC-1::GFP].

weIs12[unc-119(+) + pie-1p::GFP::csnk-1].

jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.

jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. Maintain at 20-25C. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Maintain at 20-25C. Derived by crossing JBL1 and TH27. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Maintain at 20-25C. Derived by crossing JBL1 and JH2108. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

Heterozygotes are slow (weak) Uncs and segregate paralyzed Uncs and early larval lethals. Dead larvae (ut111 homozygotes) are short, 2-fold and have an irregular shape.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

Hesitation in crossing an aversive ion. Defective in behavioral plasticity after conditioned with NaCl and starvation or with temperature and starvation.

gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.

jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Temperature-sensitive. Grows well at 15C; embryonic lethal at 25C. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.