Search Strains

jcpSi3 [ins-37p::ins-37::eGFP::ins-37 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi12 [W04G5.8p::W04G5.8::eGFP::W04G5.8 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

Starved; feeding defective; lacks M3 neurotransmission. From DA1051. DA1051 has bor-1 in the background. bor-1 has been crossed out in JD105.

vuEx90 [avr-14p::GFP]. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Pharyngeal pumping anomalies. Arecoline resistance. Locomotion variant. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.

Locomotion and feeding defects. Triple mutant lacks all muscarinic signalling. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.

Slow pumping. vu227 is the allele that is actually present in strains DA1316 and DA1370, not ad1051. For those working with DA1316 and DA1370 it may be useful to have an avr-15(vu227) single mutant for comparison. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Slow pumping. High reversal frequency. Ivermectin resistant. This strain is a replacement for the strain DA1316 currently in the CGC stock and whose genotype is actually avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9.

Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

mwEx443 [pat-3(+) + sur-5::GFP]. Pick GFP+ to maintain. mwEx443 contains wild type contains pat-3 genomic DNA, rescues pat-3 null allele. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.

Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Weak Emb and Him. N2 parental background. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.

Weak Emb and Him. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.

mtEx60 [numr-1p::GFP + rol-6(su1006)]. Maintain under normal conditions by picking rollers. Reference: Tvermoes B, et al. (2010) J Cell Sci 123:2124-34.

mtEx63 [numr-1p::numr-1::GFP + rol-6(su1006)]. Maintain under normal conditions by picking rollers. Reference: Tvermoes B, et al. (2010) J Cell Sci 123:2124-34.

vpIs9 [unc-119(+) + elt-1::GFP] Expresses in hypodermal precursor cells in early embryo and seams cells in late embryos and in seam cells at a low level throughout post-embryonic development. Also in ventral cord and retropharyngeal ganglion in larvae and adults, and vulval muscles in adults.

vpIs1 [lin-15(+) + elt-3::GFP].

Superficially wild-type.

axIs36 [pes-10::GFP + dpy-20(+)] X. Slightly dumpy.

axEx73 [pie-1p::pie-1::GFP + rol-6(su1006) + N2 genomic DNA]. pie-1::GFP is expressed in embryos and oocytes. This array may have integrated spontaneously since the strain segregates 100% Rollers.

axIs1140 [pie-1p::GFP::mbk-2 + unc-119(+)].

axIs1427 [pCG26/ LAP-tag DCP-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87.

axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82.

axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

axIs1506 [pie-1p::GFP::exos-1::exos-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.

axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

axIs1534 [pie-1p::GFP::him-3 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C to retain transgene expression. GFP expressed in synapses. Weaker expression in oocytes and pachytene germline.

axIs1577 [pie-1p::GFP::histone H2B::nos-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1584 [pie-1p::GFP::histone H2B::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1609 [pie-1p::GFP::histone H2B::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.