More Fields
Strain Species Genotype
JCM1 C. elegans hyl-2(gnv1) X. Show Description
gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.
RB1498 C. elegans hyl-2(ok1766) X. Show Description
K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807