Search Strains

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.

Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1 xpf-1 double homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.

Superficially wild-type. Deletion site verified by PCR. Reference: Muzzini DM, et al. DNA Repair (Amst.) 2008 Jun 1;7(6):941-50.

gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.

gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.

Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Mos transposon insertion into apn-1; insertion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

ddEx17 [glh-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

ddEx69 [brd-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Maintain by picking wild-type (non-Unc) animals. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

Superficially wild-type. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.

Defective phototaxis (light avoidance). To identify lite-1(xu7) homozygotes, place day 1 adults on a freshly seeded NGM plate with a thin lawn of OP50. Deliver 2 second pulses of short wavelength light (UV, purple, blue) from an arc lamp to the head of a worm that is slowly moving forward through a 5-10x objective lens in conjunction with a room lens under a fluorescent dissection scope. Manually move the plate so only the anterior of the worm appears in the field of view. Wild-type worms respond by initiating reversals while homozygous mutants do not. Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.

xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.

Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Wild type. Low Tc1 copy number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).

Wild type. Low copy Tc1 number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).

A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).

vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.

vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.

vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.

Male-female. Maintain at 20C or warmer; grows faster at 25C. Isofemale line isolated from rotting banana stem at Saguna Baug, Neral, India on 1 Dec 2022. GPS 19.0425, 73.3261. 18S closest to C. parvicauda (2022). Easier to culture and freeze than C. parvicauda; freeze with DMSO/Dextran protocol. Reference: Devi, et al., in preparation.

uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]; appears to map to LG V. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees; sick at 25 C. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID* and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.

teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.

teIs2 [pie-1p::GFP::pop-1(cDNA)::pie-1 3' UTR + unc-119(+)] IV. GFP signal is stable at 16-25C and shows pop-1 asymmetry. Superficially wild-type. Reference: Robertson SM, et al. Development. 2017 Feb 1;144(3):419-429.

teIs18 [sdz-23p::GFP::H2B::pie-1 3'UTR + Cbr-unc-119(+)]. Superficially wild-type. Integrated array carrying sdz-23 (F58G4.4) promoter fusion with bright GFP expression in E cell. Reference: Shetty P, et al. Dev Biol. 2005 Sep 15;285(2):584-92.

teIs84 [end-3p::GFP::H2B + unc-119(+)] X. Him. Superficially wild-type. Integrated E-lineage specific GFP reporter. Reference: Robertson SM, et al. PLoS One. 2014 Sep 2;9(9):e106309.

Temperature sensitive. Wild type at 15C; lethal at 22.5C.

Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

Superficially wild-type.

Superficially wild-type.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.