Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS3506 C. elegans syIs56 V. Show Description
syIs56 [ceh-2::YFP + unc-119(+)] V. Expressed in vulB and vulC. Do not distribute this strain; other labs should request it from the CGC.
PS3517 C. elegans unc-119(ed4) III; syIs57 X. Show Description
syIs57 [cdh-3::CFP + unc-119(+)]. Unsure if unc-119(ed4) remains in the background. Do not distribute this strain; other labs should request it from the CGC.
PS3525 C. elegans syIs59 X. Show Description
syIs59 [egl-17::CFP + unc-119(+)] X. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC.
PS3526 C. elegans syIs60 II; unc-119(ed4) III. Show Description
syIs60 [F47B8.6::GFP + unc-119(+)] II. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.
PS3527 C. elegans syIs61 V. Show Description
syIs61[F47B8.6::GFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.
PS3528 C. elegans syIs51 V; syIs55 X. Show Description
syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.
PS3551 C. elegans hsf-1(sy441) I. Show Description
Defects in egg laying. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC.
PS3653 C. elegans ipp-5(sy605) X. Show Description
Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC.
PS3662 C. elegans syIs63. Show Description
syIs63 [cog-1::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.
PS3664 C. elegans unc-119(ed4) III; syIs65 IV. Show Description
syIs65 [pT100.18(B0034.1::pes-10::GFP) + unc-119(+)] IV. unc-119(ed4) may have been crossed out. Do not distribute this strain; other labs should request it from the CGC.
PS3665 C. elegans syIs66 II; unc-119(ed4) III. Show Description
syIs66 [B0034.1::pes-10::GFP + unc-119(+)] II. Expressed in vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.
PS3666 C. elegans syIs67 V. Show Description
syIs67 [zmp-1::pes-10::cfp + unc-119(+)]V. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC.
PS3667 C. elegans unc-119(ed4) III; syIs68 IV. Show Description
syIs68 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC.
PS3721 C. elegans syIs76 IV. Show Description
syIs76 [zmp-1::pes-10::CFP + unc-119(+)] IV. Expressed in vulA and vulE. Do not distribute this strain; other labs should request it from the CGC.
PS3722 C. elegans unc-119(ed4) III; syIs101 IV. Show Description
syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.
PS3724 C. elegans unc-119(ed4) III; syIs102 X. Show Description
syIs102[T04B2.6::cfp + unc-119(+)] X. Expressed in vulB and vulD. Do not distribute this strain; other labs should request it from the CGC.
PS3728 C. elegans syIs77 II. Show Description
syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.
PS3729 C. elegans unc-119(ed4) III; syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Do not distribute this strain; other labs should request it from the CGC.
PS3808 C. elegans unc-119(ed4) syIs80 III. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. Received new strain from Bhagwati Gupta on April 7, 2008.
PS3931 C. elegans ref-1(ok288) II. Show Description
P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) and ectopic postdeirid generated by V6 (low penetrance). Do not distribute this strain; other labs should request it from the CGC.
PS3972 C. elegans unc-119(ed4) syIs90 III. Show Description
syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC.
PS4087 C. elegans dpy-22(sy622) X. Show Description
Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC.
PS4112 C. elegans plc-1(rx1) X; kfEx2. Show Description
kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC.
PS4198 C. elegans unc-119(ed4) III; syIs103. Show Description
syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.
PS4226 C. elegans unc-119(ed4) III; syIs53 V. Show Description
syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.
PS4230 C. elegans unc-103(sy557) III; him-5(e1490) V. Show Description
Semi-dominant. 60% of adult males will have protruding spicules; Prc (protraction constitutive) phenotype. Larval animals and adult hermaphrodites do not display any gross abnormal phenotypes. Prc males have a mating efficiency of 0. Non-Prc males have a mating efficiency of 3. Do not distribute this strain; other labs should request it from the CGC.
PS4263 C. elegans egl-30(md186) I; dpy-20(e1282) IV; syIs105. Show Description
syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
PS427 C. elegans lin-45(sy96) IV. Show Description
Vulvaless. 90% of the progeny are larval lethal-most die as L1s. Males are mating defective. Do not distribute this strain; other labs should request it from the CGC.
PS4308 C. elegans unc-119(ed4) III; syIs107. Show Description
syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.
PS4330 C. elegans spe-41(sy693) III; him-5(e1490) V. Show Description
Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC.
PS436 C. elegans let-60(sy93) IV. Show Description
Dominant Vul (>99% Egl). Do not distribute this strain; other labs should request it from the CGC.
PS4411 C. elegans unc-119(ed4) III; syIs123 X. Show Description
syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC.
PS443 Panagrolaimus sp. Panagrolaimus sp. wild isolate. Show Description
Armenian worm. Male/Female strain. Maintain by mating. Do not distribute this strain; other labs should request it from the CGC.
PS4432 C. elegans him-5(e1490) V; dpy-22(sy665) X. Show Description
Enhances vulval development in the presence of let-23(sa62gf) in hermaphrodites and males. Animals are Dpy. Hermaphrodites are Egl. Males have abnormal ray development. Do not distribute this strain; other labs should request it from the CGC.
PS4441 C. elegans syIs118 I; unc-119(ed4) III. Show Description
syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC.
PS4444 C. elegans unc-119(ed4) syIs129 III. Show Description
syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC.
PS4558 C. elegans unc-119(ed4) syIs137 III. Show Description
syIs137 [unc-119(+) + fos-1b::CFP-TX]. Integrant of fos-1b transcriptional reporter. Do not distribute this strain; other labs should request it from the CGC.
PS4657 C. elegans him-5(e1490) V; syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Not sure if unc-119(ed4) from the parent strain is still present. Do not distribute this strain; other labs should request it from the CGC.
PS468 C. elegans let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. Show Description
Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC.
PS4865 C. elegans unc-119(ed4) III; him-5(e1490) V; syEx684. Show Description
syEx684 [unc-119(+) + fos-1a/b::GFP-TL]. Ex line of functional fos-1 gene tagged with GFP at the C-terminus. Pick WT to maintain. Throws males. Do not distribute this strain; other labs should request it from the CGC.
PS4997 C. elegans unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.
PS524 C. elegans let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC.
PS529 C. elegans unc-101(sy108) I. Show Description
Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC.
PS5332 C. elegans unc-119(ed4) III; him-5(e1490) V; syIs187. Show Description
syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC.
PS536 C. elegans unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC.
PS538 C. elegans unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
PS5527 C. elegans pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. Show Description
syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
PS5551 C. elegans pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. Show Description
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC.
PS5552 C. elegans unc-119(ed4) III; syEx974. Show Description
syEx974 [POPFOP + unc-119(+)]. Pick non-Unc and RFP+. Do not distribute this strain; other labs should request it from the CGC.
PS5970 C. elegans him-5(e1490) syIs197 V. Show Description
syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.