| VH7211 |
C. elegans |
mrpl-40(hd7198[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/ oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] III. Show Description
Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7212 |
C. elegans |
+/nT1 [umnls49] IV; K07F5.15(hd7202[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7213 |
C. elegans |
mrpl-39(hd7213[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAAAAAACGATAAAAAATGCTTATAAAAT; Right flanking sequence: AGGTGATCGCAGTGCCAACGAGTGTAGCAG. sgRNA #1: ATTATTTTCAGACGCTGTCC; sgRNA #2: CCGCGAAGAGAAGCAATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7214 |
C. elegans |
+/nT1 [umnls49] IV; ttr-33(hd7205[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7215 |
C. elegans |
mcat-1(hd7179[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/ lin-42(tmIs1226) II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VX300 |
C. elegans |
yfSi1 II. Show Description
yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081
|
|
| XIL9127 |
C. elegans |
nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV. Show Description
LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| YY1492 |
C. elegans |
mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
| ZM10311 |
C. elegans |
unc-25(e156) III; ljIs131; hpIs758. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM10339 |
C. elegans |
hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
| ZM10538 |
C. elegans |
hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVBs calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
|
|
| ZM10755 |
C. elegans |
hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals.
|
|
| ZM10786 |
C. elegans |
hpIs721; hpIs811. Show Description
hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.
|
|
| ZM10806 |
C. elegans |
hpIs824. Show Description
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.
|
|
| ZM10942 |
C. elegans |
lin-15B&lin-15A(n765) X; hpIs774; hpEx4292. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA.
|
|
| ZM11034 |
C. elegans |
hpIs819; hpIs810. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).
|
|
| ZM11082 |
C. elegans |
twk-40(hp834) III; hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.
|
|
| ZM11085 |
C. elegans |
hpIs814; hpEx4363. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA.
|
|
| ZM11151 |
C. elegans |
hpIs758; hpIs814. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.
|
|
| SU1085 |
C. elegans |
tes-1(jc110[mScarlet-1::FLAG::tes-1 + LoxP511]) IV. Show Description
mScarlet and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
|
|