| WU1500 |
C. elegans |
hizr-1(am286) X. Show Description
High zinc transcriptional activation - deficient (Zad-d). Avoid high zinc concentrations. [NOTE: this strain was previously described as hizr-1(am285); the correct allele name hizr-1(am286).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
|
|
| WU1563 |
C. elegans |
hizr-1(am285) X. Show Description
Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
|
|
| WY114 |
C. elegans |
pha-1(fd1) III. Show Description
Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.
|
|
| WY184 |
C. elegans |
xnp-1(fd2) I. Show Description
WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.
|
|
| X1666 |
Escherichia coli |
E. coli. Show Description
Bacteria. E. coli. Plasmidless, NAL-resistant, ARA-minus, Good growth, high density. Uracil prototroph. Biosafety Level: BSL-1.
|
|
| XE1910 |
C. elegans |
aex-6(sa699) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. High regeneration. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428.
|
|
| YL206 |
C. elegans |
unc-119(ed3) III; vrEx6. Show Description
vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.
|
|
| ZT68 |
C. elegans |
csr-1(fj162) IV. Show Description
RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.
|
|
| AGK192 |
C. elegans |
unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
|
|
| AH1747 |
C. elegans |
unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| AML546 |
C. elegans |
wtfEx496. Show Description
wtfEx496 [pAS3-rig-3p::AI::gur-3G::SL2::tagRFP::unc-54 3'UTR + pAS3-rig-3p::AI::prdx-2G::SL2::tagBFP::unc-54 3'UTR]. Pick animals either BFP or RFP expression in head neurons to maintain. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) alongside fluorescent proteins tagBFP and tagRFP in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM using rig-3 promoter. Worms exhibit higher reversal rate on exposing to blue light (peak value ~470) compared to controls. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938.
|
|
| AV221 |
C. elegans |
unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
|
|
| AY177 |
C. elegans |
acEx177. Show Description
acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.
|
|
| BOX215 |
C. elegans |
erm-1(mib16[erm-1[T544D]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
|
|
| BOX218 |
C. elegans |
erm-1(mib19[erm-1[T544A]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
|
|
| BS3727 |
C. elegans |
lip-1(ok154) IV. Show Description
Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
|
|
| BW1809 |
C. elegans |
gpa-16(it143) I; him-5(e1490) V. Show Description
Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs.
|
|
| BX26 |
C. elegans |
fat-2(wa17) IV. Show Description
No delta 12 fatty acid desaturase activity. Slow growing. Unc. Dpy. Cold sensitive - maintain at 20C or higher.
|
|
| CA1352 |
C. elegans |
ieSi64 II; unc-119(ed3) III. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3' UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. Comparing to CA1472, this strain expresses a higher level of TIR1 and can induce a faster degradation of AID-tagged proteins in the germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
|
|
| CB6430 |
C. elegans |
sqt-3(e2924) V. Show Description
Squat, dumpy at 15C. Inviable at higher temperatures. Deletion of most of sqt-3 coding sequence. Null by antibody staining.
|
|
| CB6449 |
C. elegans |
sqt-3(e2909) V. Show Description
Weak dumpy. Variable tail abnormal at 20C or higher. Cold-sensitive: most arrest as pretzel-stage embryos, with some escapers arresting as severely distorted L1 larvae at 15. Unusual missense allele (K280E) of sqt-3, cold-sensitive lethal and suppressor of dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.
|
|
| CF1700 |
C. elegans |
daf-16(mu86) I; mes-1(bn7) X; muEx248. Show Description
muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
|
|
| CL2120 |
C. elegans |
dvIs14. Show Description
dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.
|
|
| CL2331 |
C. elegans |
dvIs37. Show Description
dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.
|
|
| CL6049 |
C. elegans |
dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18.
|
|
| CP161 |
C. briggsae |
Cbr-unc-119(nm67) III; nmIs7. Show Description
nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
|
|
| DA1316 |
C. elegans |
avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Show Description
Highly resistant to ivermectin. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
|
|
| DR2078 |
C. elegans |
mIn1 [dpy-10(e128) mIs14]/bli-2(e768) unc-4(e120) II. Show Description
WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.
|
|
| EG8040 |
C. elegans |
oxTi302 I; oxTi75 II; oxTi411 unc-119(ed3) III; him-8(e1489) IV. Show Description
oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]; inserted in Chr. I: 10,166,145. oxTi75 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] II; inserted in Chr. II: 5,448,544. oxTi411 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] inserted in Chr. III: 6,076,837. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.
|
|
| EG8041 |
C. elegans |
oxTi76 IV; oxTi405 him-5(e1490) V; oxTi421 X. Show Description
oxTi76 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)]; inserted in Chr. IV: 11,899,008. oxTi405 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]; inserted in Chr. V: 15,838,568. oxTi421 [eft-3p::mCherry::tbb-2 3'UTR] inserted in Chr. X: 6,180,397. Him. Somewhat sick at higher temperatures. Maintain at 20C or below. This mapping strain uses three dominant fluorescent insertions that can be distinguished when scoring segregation. Please see www.wormbuilder.org for additional strain information.
|
|
| EL69 |
C. elegans |
unc-32(e189) glp-1(q231) III; sog-3(q294) IV. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-3.
|
|
| EU3115 |
C elegans |
klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
| EU3201 |
C elegans |
klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
| EU603 |
C. elegans |
lit-1(or131) III; him-8(e1489) IV. Show Description
or131 mutant embyros have a highly penetrant mom-like defect with mutant embryos lacking gut and making extra pharyngeal tissue at 25C. Maintain at 15C.
|
|
| EU931 |
C. elegans |
zyg-8(or490) III; lin-2(e1309) X. Show Description
Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C. Viable embryos at permissive temperature of 15C. Mitotic spindle in one-cell stage embryo assembles normally, but microtubules destabilize at anaphase and spindle becomes mis-positioned toward the posterior pole leading to highly abnormal cleavage and chromosome segregation defects. References: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75. Bellanger JM, et al. J Cell Sci. 2007 Aug 15;120(Pt 16):2963-73.
|
|
| FN64 |
C. elegans |
fnEx4. Show Description
fnEx4 [unc-85::GFP + rol-6(su1006)]. Rollers. GFP highly expressed in embryos, VPNs in L1, Intestine in L2, VPNs in L3-L4. Maintain by picking GFP+ rollers. Reference: Grigsby IF & Finger FP. (2008) Dev Biol 319(1):100-9.
|
|
| HA328 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx233. Show Description
rtEx233 [nlp-11p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA329 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx234. Show Description
rtEx234 [nlp-13p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv or GFP+ to maintain array.
|
|
| HA353 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx247. Show Description
rtEx247 [nlp-14p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA357 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx251. Show Description
rtEx251 [nlp-15p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA367 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx256. Show Description
rtEx256 [nlp-18p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA371 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx260. Show Description
rtEx260 [nlp-19p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA444 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx330. Show Description
rtEx330 [nlp-21p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HA450 |
C. elegans |
lin-15B&lin-15A(n765) X; rtEx336. Show Description
rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
|
|
| HG231 |
C. elegans |
age-2(yw23) I. Show Description
HG231 exhibits an approximately 20% increase in mean, median and maxium lifespans compared to N2. HG231 exhibits somewhat reduced fertility and somewhat longer development time than N2. It has a normal appearance, movements and mating behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
|
|
| HG284 |
C. elegans |
age-2(yw23) I; age-1(hx546) II. Show Description
This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
|
|
| IC699 |
C. elegans |
sax-3(ky123) ; quEx168. Show Description
quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.
|
|
| IW465 |
C. elegans |
tax-2(iw80) I. Show Description
Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
|
|
| JK967 |
C. elegans |
ubr-5(q298) I; unc-32(e189) glp-1(q231) III. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-1. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK968 |
C. elegans |
unc-32(e189) glp-1(q231) III; sog-6(q306) IV. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-6. Do not distribute this strain; other labs should request it from the CGC.
|
|