Strain Information
| Name | LBV5 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | str-217(ejd1) V. |
| Description | DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows):GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAA ejd1: GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>AAAAAAAA Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123. |
| Mutagen | CRISPR targeted mutation |
| Outcrossed | x0 |
| Made by | Emily Dennis |
| Laboratory | LBV |
| Reference | Dennis EJ, Dobosiewicz M, Jin X, Duvall LB, Hartman PS, Bargmann CI, and Vosshall LB. A natural variant and engineered mutation in a GPCR promote DEET resistance in C. elegans (2018) Nature 562, 119-123. |
Sign in
or
register an account if you want to order this strain.