| DR2208 |
C. elegans |
daf-16(m26) I; rrf-3(b26) II; liv-4(m872) V. Show Description
daf-d on starvation. Sterile at 25C. Maintain at 15C. Mild Unc.
|
|
| DR234 |
C. elegans |
dpy-5(e61) daf-16(m27) I. Show Description
Dauer defective. Dpy.
|
|
| DR240 |
C. elegans |
dpy-11(e224) unc-42(e270) daf-11(m84) V. Show Description
Temperature sensitive dauer constitutive. Dpy. Unc.
|
|
| DR244 |
C. elegans |
daf-19(m86) sqt-1(e1350) II. Show Description
Temperature sensitive dauer constitutive. Many dauers at 15C. Dpy. Heterozygotes Roll.
|
|
| DR245 |
C. elegans |
daf-14(m77) unc-22(m52) IV. Show Description
Temperature sensitive dauer constitutive. Dominant Twitcher
|
|
| DR25 |
C. elegans |
daf-12(m25) X. Show Description
Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]
|
|
| DR26 |
C. elegans |
daf-16(m26) I. Show Description
Dauer defective-leaky. Somewhat small. Suppresses daf-2.
|
|
| DR27 |
C. elegans |
daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
|
|
| DR411 |
C. elegans |
dpy-13(e184)/daf-15(m81) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Dpy and dauers. Dauers are lethal and SDS-sensitive. NOTE: WT recombinants that have lost dpy-13 can quickly overtake a population.
|
|
| DR412 |
C. elegans |
daf-15(m81)/unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Unc, and lethal dauers. Dauers are SDS-sensitive.
|
|
| DR427 |
C. elegans |
daf-12(m116) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
|
|
| DR431 |
C. elegans |
daf-19(m86)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dauers and DpyUnc.
|
|
| DR442 |
C. elegans |
unc-8(e49) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Unc.
|
|
| DR47 |
C. elegans |
daf-11(m47) V. Show Description
Temperature sensitive. Leaky at 25C. Dauers recover poorly at 15C. Dauers escape plates. Recessive. Chemotaxis defective (Na+). Received new stock from Riddle lab in November 2006.
|
|
| DR66 |
C. elegans |
daf-13(m66) X. Show Description
SDS sensitive dauers. Non-crowder.
|
|
| DR732 |
C. elegans |
daf-15(m81) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Twitchers which are dauers (dauer constitutive) and dead eggs. Maintain by picking WT. Hets twitch in 1% nicotine.
|
|
| DR77 |
C. elegans |
daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
|
|
| DR86 |
C. elegans |
daf-19(m86) II. Show Description
Temperature sensitive dauer constitutive. Difficult to grow. 100% dauers at 25C. 90% dauers at 15C.
|
|
| DR978 |
C. elegans |
daf-12(m419) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, and intestine. Class III allele.
|
|
| DR979 |
C. elegans |
daf-12(m420) X. Show Description
daf-d. Weak heterochronic phenotypes in intestine. Class III allele.
|
|
| DR980 |
C. elegans |
daf-12(m421) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
|
|
| DR981 |
C. elegans |
daf-12(m422) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
|
|
| DR983 |
C. elegans |
daf-12(m424) X. Show Description
daf-d. Weak heterochronic phenotypes in intestine. Class III allele.
|
|
| DV3208 |
C. elegans |
daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
|
|
| DV3525 |
C. elegans |
daf-15(re257[daf-15::mNG::AID*]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
|
|
| ENL62 |
C. elegans |
daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
|
|
| ENL63 |
C. elegans |
daf-16(mgDf47) I; sma-10(ok2224) IV; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.
|
|
| ENL67 |
C. elegans |
daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
|
|
| ENL68 |
C. elegans |
sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
|
|
| ET507 |
C. elegans |
daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.
|
|
| FK183 |
C. elegans |
daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
|
|
| GA132 |
C. elegans |
daf-16(mgDf50) I; daf-2(m646) III. Show Description
Maintain at 15C.
|
|
| GA158 |
C. elegans |
daf-16(mgDf50) I; daf-2(m65) III. Show Description
Maintain at 15C.
|
|
| GA2003 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) III; wuIs305. Show Description
wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.
|
|
| GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GR1307 |
C. elegans |
daf-16(mgDf50) I. Show Description
Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
|
|
| GR1308 |
C. elegans |
daf-16(mg54) I; daf-2(e1370) III. Show Description
mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
|
|
| GR1309 |
C. elegans |
daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
|
|
| GR1352 |
C. elegans |
daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
|
|
| GR1895 |
C. elegans |
daf-2(e1370) III; mgIs67. Show Description
mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
|
|
| HGA8004 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HGA8005 |
C. elegans |
glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
|
|
| HR83 |
C. elegans |
mel-24(ct59) dpy-20(e1282)/unc-24(e138) daf-15(m81) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.
|
|
| HT1881 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1882 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs13. Show Description
lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1883 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1888 |
C. elegans |
daf-16(mgDf50) I; unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Over-expresses daf-16a. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1889 |
C. elegans |
daf-16(mgDf50) I; unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Over-expresses daf-16f. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
|
|
| HT1890 |
C. elegans |
daf-16(mgDf50) I; daf-2(e1370) III. Show Description
Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
|
|
| IU10 |
C. elegans |
daf-16(mgDf47) I; rrf-3(pk1426) II. Show Description
|
|