| VC141 |
C. elegans |
zif-1(gk117) III. Show Description
F59B2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| BN1097 |
C. elegans |
bqSi1030 II; bqSi548 IV. Show Description
bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the hypodermis via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and hypodermal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| BN1117 |
C. elegans |
bqSi1030 II; bqSi508 IV. Show Description
bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi508 [elt-2p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the intestine via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and intestinal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| CZ24092 |
C. elegans |
gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
|
|
| CZ24274 |
C. elegans |
dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
|
|
| FT1341 |
C. elegans |
xnIs23. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. Transgene insertion expressing ZF1::GFP::CDC-42 ubiquitously in somatic cells. Transgenic cdc-42 protein subject to ZIF-1-dependent degradation. Might still have unc-119(ed3) in the background. Reference: Armenti STet al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.
|
|
| FT1450 |
C. elegans |
unc-119(ed3) III; xnIs23; xnEx342. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx342 [rab-3p::zif-1 + rab-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgenic cdc-42 is subject to ZIF-1-dependent degradation. Neuronal cells inheriting xnEx342 express ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
|
|
| FT1481 |
C. elegans |
unc-119(ed3) III; xnIs23; xnEx350. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx350 [elt-2p::zif-1 + elt-2p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgenic cdc-42 subject to ZIF-1-dependent degradation. Intestinal cells that inherit xnEx350 express ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
|
|
| FT1547 |
C. elegans |
unc-119(ed3) III; xnIs23; xnEx380. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgeneic cdc-42 is subject to ZIF-1 dependent degradation. In cells inheriting xnEx380, there is heatshock-dependent expression of ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
|
|
| FT1607 |
C. elegans |
xnIs520. Show Description
xnIs520 [cdc-42p::zif-1 + cdc-42p::mCherry]. Ubiquitous ZIF-1 expression and mCherry in all somatic cells. Reference: Armenti ST et al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.
|
|
| FT36 |
C. elegans |
unc-101(m1) par-6(zu170) I; zuIs43. Show Description
zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. Transgenic PAR-6 is subject to ZIF-1-dependent degradation. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).
|
|
| JJ1440 |
C. elegans |
unc-119(ed3) III; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.
|
|
| JJ1494 |
C. elegans |
unc-119(ed3) III; zuIs58. Show Description
zuIs58 [par-6::PAR-6::ZF1::GFP + unc-119(+)]. Transgenic PAR-6 is subject to ZIF-1-dependent degradation.
|
|
| JJ1600 |
C. elegans |
par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
|
|
| JLF104 |
C. elegans |
zyg-9(wow12[ZF1::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of zyg-9 protein by providing a source of ZIF-1. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
|
|
| JLF145 |
C. elegans |
zif-1(gk117) III; air-1(wow14[air-1::ZF1::GFP::3xFLAG]) V. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF155 |
C. elegans |
zif-1(gk117) III. Show Description
Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC
|
|
| JLF173 |
C. elegans |
gip-1(wow25[tagRFP-T::3xMyc::gip-1]) zif-1(gk117) III. Show Description
tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF212 |
C. elegans |
par-6(wow31[par-6::ZF1::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of par-6 by providing ZIF-1. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437.
doi: 10.7554/eLife.64437. PMID: 34137371.
|
|
| JLF238 |
C. elegans |
tpxl-1(wow34[ZF1::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of tpxl-1 protein by providing a source of ZIF-1. GFP expression is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
|
|
| JLF24 |
C. elegans |
gip-1(wow5[ZF1::GFP::gip-1]) zif-1(gk117) III. Show Description
ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF302 |
C. elegans |
ebp-2(wow47[ebp-2::GFP::3xFLAG]) II; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| JLF348 |
C. elegans |
mzt-1(wow51[GFP::3xFLAG::mzt-1]) I; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous mzt-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
|
|
| MLC1092 |
C. elegans |
lucSi100 II; unc-119(ed3) III. Show Description
lucSi100 [hsp16.41::vhhGFP4::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a GFP-nanobody::zif-1 fusion transgene under a heat-shock promoter. Allows conditional depletion of GFP-tagged proteins in all tissues via heat-shock expression of anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). (Wang et al. (2017). A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
|
|
| MLC1094 |
C. elegans |
lucSi102 II; unc-119(ed3) III. Show Description
lucSi102 [hsp16.41::zif-1::SL2::mCherry::his-11::tbb-2 3'UTR] II. Superficially wild-type morphology. Single-copy insertion of a zif-1 transgene under a heat-shock promoter. Used as control for MLC1092 or for conditional depletion of ZF1 degron-tagged proteins (aka ZF) in all tissues via heat-shock expression of ZIF-1. (Wang et al. (2017) A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144, 2694-2701.)
|
|
| NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11
|
|
| OD2442 |
C. elegans |
ltSi794 II; unc-119(ed3) III. Show Description
ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
|
|
| OD2768 |
C. elegans |
ltSi910 II; unc-119(ed3) III. Show Description
ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2770 |
C. elegans |
ltSi912 II; unc-119(ed3) III. Show Description
ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2772 |
C. elegans |
ltSi914 II; unc-119(ed3) III. Show Description
ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2773 |
C. elegans |
ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2984 |
C. elegans |
ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
|
|
| TV24185 |
C. elegans |
zif-1(gk117) III; wyEx9745. Show Description
wyEx9745 [unc-86p::mCherry::PLCdeltaPH + odr-1p::GFP]. Pick GFP+ animals to maintain. zif-1(gk117) is a punitive null allele. mCherry expression in early PVD membrane. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.
|
|
| TX1246 |
C. elegans |
unc-119(ed3) III; teIs113. Show Description
teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.
|
|
| ZM10113 |
C. elegans |
twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone.
|
|