| COP2772 |
oma-1(knu1284[delta TZF])::GFP IV; oma-2(ne5034[AID*::oma-2] neSi101 V. |
knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014. |
| KDK94 |
otIs672; otIs696. |
otIs672 [rab-3p::NLS:: GCaMP6s + arrd-4p::NLS::GCaMP6s]. See description of strain OH16230 for full description of otIs696 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. 2-nonanone avoidance and electrical shock response of KDK94 are more similar to wild-type (N2) than other NeuroPAL strains. Derived by crossing parental strains OH15265 and OH15495. References: Endo Y, et al. J Biosci. 2025:50:52. PMID: 40619772. NeuroPAL reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642. |
| RG3521 |
F55C10.5(ve1021[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1579 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGGAATGCCTCGGCTATTTTTCAGTTTTT ; Right flanking sequence: Ctttatttttaagtttttttaatctccctt. F55C10.5 crRNA A: CGGTAAAATTCAGTCTGTCT; F55C10.5 crRNA B: TTTATTATGTGCACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| OH18902 |
degt-1(ot1445[degt-1::GFP]) V. |
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| PHX9045 |
degt-1(syb9045[degt-1::SL2::GFP::H2B]) V. |
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous degt-1 locus. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| OH19034 |
degt-1(ot1466) V. |
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
| JPS725 |
ced-6(n1813) III; vxEx725. |
vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930. |
| JPS1809 |
vxIs601; bcIs49. |
bcIs49 [egl-1p::mitoGFP]. vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons through adult stage. Transient mCherry expression in apoptotic cells before death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930. |
| JPS601 |
vxIs601. |
vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons and apoptotic cells. Reference: Cohn J, et al. G3 (Bethesda). 2019 Nov 5;9(11):3703-3714. doi: 10.1534/g3.119.400654. PMID: 31519744. |
| APL5 |
ljfSi2 I. |
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL23 |
ljfSi10 II; egl-17(ljf7[egl-17::mNG::3xFlag]) X. |
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL126 |
ljfSi33 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. |
ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL130 |
ljfSi10 II; egl-17(ljf25[egl-17::mNG::nlg-1 C-terminus]) X. |
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously membrane tethered allele of EGL-17::mNG that is competent for contact-dependent signaling but does not diffuse extracellularly. egl-17(ljf25) was generated by inserting mNG and the transmembrane and C-terminal domains of NLG-1 at the C-terminus of egl-17. Sex myoblast migration defects, Egl. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL199 |
ljfSi10 II; egl-17(ljf24[egl-17::SL2::mNG::PH]) X. |
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously engineered transcriptional reporter that can be used to visualize membranes of egl-17-expressing cells. egl-17(ljf24) was generated by inserting SL2::mNG::PH following the egl-17 stop codon. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL242 |
ljfSi32 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. |
ljfSi32 [egl-20 enhancer(-1261 – 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| APL622 |
ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. |
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding
domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| LP515 |
cpIs89 I; cpIs85 II; egl-20(cp221[egl-20::mNG::3xFlag]) IV. |
cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| LP815 |
cpIs158 I; cpIs130 II; egl-20(cp400[egl-20::YPET::3xFlag]) IV. |
cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367. |
| NJ602 |
ifc-2(rh209) X. |
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271. |
| NJ678 |
ifc-2(rh247) X. |
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271. Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK201 |
qpIs95 X. |
qpIs95 [exc-9p::mCherry::eea-1] X. Expression of mCherry-tagged EEA-1 of early endosomes in cytoplasm of excretory canals along nearly entire length of worm. Fluorescence not strong. Generated in N2 background. Construct integrated on X chromosome. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK210 |
qpIs100. |
qpIs100 [exc-9p::mCherry::rab-7]. Expression of mCherry-tagged RAB-7 of late endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK206 |
qpIs98. |
qpIs98 [exc-9p::mCherry::glo-1]. Expression of mCherry-tagged GLO-1 of lysosomes in cytoplasm of excretory canals along nearly entire length of worm. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK211 |
qpIs101 X. |
qpIs101 [exc-9p::mCherry::rme-1] X. N2 containing construct conferring expression of mCherry-tagged RME-1 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK205 |
qpIs97 V. |
qpIs97 [exc-9p::mCherry::rab-11] V. Expression of mCherry-tagged RAB-11 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK220 |
qpIs103. |
qpIs103 [exc-9p::mCherry::GRIP]. Expression of mCherry-tagged mammalian GRIP of Golgi in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK204 |
qpIs96. |
qpIs96 [exc-9p::mCherry::cdc-42]. Expression of mCherry-tagged cytoplasmic CDC-42. Generated in N2 background. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936. |
| BK530 |
ifc-2(qp110) X. |
Large cysts in excretory canal, sometimes visible with dissecting microscope. qp110 deletion removes part of promoter and first 2 bases of start codon of ifc-2. Deletion of bases 650114 ttttctagggtcctcatcacaaAT 650091 of Chr X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901. |
| BK531 |
ifc-2(qpIs111[gfp::3xflag::ifc-2]) X. |
GFP::3xFlag tag inserted at N-terminus of endogenous ifc-2 locus. Strong GFP signal forming meshwork at lumenal surface of excretory canal cell, visible along entire canal lengths. Insertion between bases 650089 and 650090 of Chrom. X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901. |
| BK532 |
ifa-4(qpIs112[mKate2::3xmyc::ifa-4]) X. |
mKate2::3xMyc tag inserted at N-terminus of endogenous ifa-4 locus. Strong mKate2 signal at lumenal surface of excretory canal cell lumen along entire canal lengths. Insertion between bases 4515979 and 4515978 of Chom. X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901. |
| BK533 |
ifc-2(qpIs111[gfp::3xflag::ifc-2]) ifa-4(qpIs112[mKate2::3xmyc::ifa-4]) X. |
GFP::3xFlag tag inserted at N-terminus of endogenous ifc-2 locus. mKate2::3xMyc tag inserted at N-terminus of endogenous ifa-4 locus. Strong GFP signal forming meshwork at lumenal surface of excretory canal cell. Strong GFPand mKate2 signal at lumenal surface of excretory canal cell lumen along entire canal lengths. qpIs112 insertion made in parental strain BK531 qpIs111. Inserted between bases 4515979 and 4515978 of Chom. X (Wormbase WS297 release). Reference: Al-Hashimi H, et al. Genetics. 2018 Oct;210(2):637-652. doi: 10.1534/genetics.118.301078. PMID: 29945901. |
| BK601 |
exc-1(rh26) X; arIs198. |
arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]. Shortened excretory canals from loss of GTPase (IRG homologue). Derived by crossing parental strains NJ51 to GS7637 and outcrossing to remove cyk-1 mutation on LG IV. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK597 |
exc-1(qp127[exc-1::gfp::3xflag]) I. |
GFP::3xFlag tag inserted at N-terminus of endogenous exc-1 locus. Strong GFP signal forming meshwork at apical (lumenal) surface of excretory canal cell canals visible along entire canal lengths. Expression also visible in uterine seam cell and distal tip cells. Inserted between bases 15477404 and 15477403 of Chrom. X (Wormbase WS297 release). Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK602 |
exc-5(rh232) IV; arIs198. |
arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]. Large cysts in excretory canal, sometimes visible with dissecting microscope. Fluorescence shows some filamentation of actin fibers at apical (lumenal) surface of cysts. Derived by crossing parental strains NJ731 to GS7637 and outcrossing 3x to remove cyk-1 mutation on LG IV. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK603 |
exc-9(n2669) IV; arIs198. |
arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]. Large cysts in excretory canal, sometimes visible with dissecting microscope. Fluorescence shows some filamentation of actin fibers at apical (lumenal) surface of cysts. Derived by crossing parental strains MT6984 to GS7637 and outcrossing 3x to remove cyk-1 mutation on LG III. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK596 |
exc-9(qp130) IV. |
CRISPR-induced deletion of bases -1 through +8 of coding region to create a knockout allele of exc-9. Large cysts in excretory canal, sometimes visible with dissecting microscope. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK585 |
exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifc-2(rh247) X. |
GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. Large cysts in excretory canal, sometimes visible with dissecting microscope, due to loss of intermediate filament-like protein IFC-2 (formerly called EXC-2). Canals labeled with GFP and 3xFlag. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Derived by crossing parental strains BK583 x NJ678 and selecting for canal cysts and fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK587 |
exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifa-4(ok1717) X. |
GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. Large cysts in excretory canal, sometimes visible with dissecting microscope, due to loss of intermediate filament IFA-4. Canals labeled with GFP and 3xFlag. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Derived by crossing parental strains BK583 x VC1221 and selecting for canal cysts and fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK588 |
exc-9(qpIs124[gfp::3xFlag::exc-9]) IV; ifa-4(qpIs112[mKate2::3xmyc::ifa-4]) X. |
mKate2::3xMyc tag inserted at N-terminus of endogenous ifa-4 locus. GFP::3xFlag tag inserted at N-terminus of endogenous exc-9 locus. GFP::3xFlag tag was inserted with repair of qp130 deletion in parental strain BK596. Strong mKate2 signal at lumenal surface of excretory canal cell lumen and along entire canal lengths. Canals labeled with GFP and 3xFlag. Derived by crossing parental strains BK583 x BK532 and selecting for canal cysts and both GFP and mKate fluorescence. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK589 |
exc-9(qpIs125[exc-9::gfp::3xFlag]) IV. |
GFP::3xFlag tag inserted at C-terminus of endogenous exc-9 locus. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK590 |
exc-9(qpIs126[mKate2::3xMyc::exc-9]) IV. |
mKate2::3xMyc tag inserted at N-terminus of endogenous exc-9 locus. Canals labeled with mKate2 and 3xMyc. Tag was inserted with repair of qp130 deletion in parental strain BK596. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| BK600 |
exc-9(qp128[gfp::3xflag::exc-9(*LIM)] *qp124) IV. |
2nd, 3rd, and 4th Cysteines in EXC-9 LIM domain replaced with Alanines in endogenoulsy-tagged exc-9 locus. Canals slightly shortened. Derived by further CRISPR modification of qp124. Reference: Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501. |
| RG3518 |
+/mT1 [umnIs52] II; D2045.9(ve1018[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Emb. Deletion of 3962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve1018 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATAGACTACTATTTGAAGGCTAACTTTCCA; Right flanking sequence: AGGAATTGTGattttatttaaattttgttt. D2045.9 crRNA A: ATTTCCCGGTCAACGCAACG; D2045.9 crRNA B: GACACCGAAACCTAAAAGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3519 |
idha-1(ve1019[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. |
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1019 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACTTATCGAACGATTTTGTGGTTCATGCCA; Right flanking sequence: TGGAAACAAAAATATTTGAGATGGAAGGAA. idha-1 crRNA A: TCGCTTTACTCCTATCCCAT; idha-1 crRNA B: TTGCCAAGCATTCTGAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3520 |
+/nT1 [umnIs49] IV; F32D8.5(ve1020[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 589 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1020 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGACAACTTAATCTTGAGTGAAATCTTCCT; Right flanking sequence: TACTTCATTTTCTTGCAAAACGATTTCCCA. F32D8.5 crRNA A: ATTAAAAGCAGGTTCAGCGC; F32D8.5 crRNA B: GTAGCGGAGTGAAAGATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| UJ1300 |
unc-9(miz81[unc-9::7xGFP11]) X; juIs463. |
juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. 7xGFP11 tag inserted into endogenous unc-9 locus. unc-9(miz81) is Unc, possibly due to increased channel activity. Reference: Hendi A, et al. Elife. 2022 Nov 15;11:e80555. doi: 10.7554/eLife.80555. PMID: 36378164. |
| UJ3233 |
cla-1(miz378[cla-1::8xwrmScarlet11]) IV. |
8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ3103 |
sng-1(miz488[sng-1::4xmScarlet11]) X; mizIs41. |
mizIs41 [mig-13p::mScarlet1-10::SL2::GFP1-10 + odr-1p::GFP]. 4xmScarlet11 tag inserted into endogenous sng-1 locus. miz488 genotyping primers: F: CGCACCTCCACCTCAATCC / R: AACACAACAAGACGGAAATACG. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ1940 |
syd-2(miz231[7xGFP11::syd-2]) X. |
7xGFP11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
| UJ2719 |
unc-10(miz404[unc-10::7xGFP11]) X. |
7xGFP11 tag inserted into endogenous unc-10 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832. |
