Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
UJ2820 cla-1(miz321[cla-1::7xGFP11]) IV. 7xGFP11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ2587 elks-1(miz365[elks-1::7xGFP11]) IV. 7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3321 syd-2(miz329 [8xwrmScarlet11::syd-2]) X. 8xwrmScarlet11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
CSG18 gsgIs2 I. gsgIs2 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (I: 2850968). Superficially wild-type. sgIs2 can be used to generate single-copy insertions in C. elegans Chromosome I. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG60 gsgIs3 II. gsgIs3 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (II: 9834540). Superficially wild-type. gsgIs3 can be used to generate single-copy insertions in C. elegans Chromosome II. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG36 gsgIs5 III. gsgIs5 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (III: 7007779). Superficially wild-type. gsgIs5 can be used to generate single-copy insertions in C. elegans Chromosome III. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG10 gsgIs1 IV. gsgIs1 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (IV: 5014948). Superficially wild-type. gsgIs1 can be used to generate single-copy insertions in C. elegans Chromosome IV. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG76 gsgIs4 V. gsgIs4 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (V: 8644845). Superficially wild-type. gsgIs4 can be used to generate single-copy insertions in C. elegans Chromosome V. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
CSG53 gsgIs8 X. gsgIs8 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bpHA2 right] (X: 798667). Superficially wild-type. gsgIs8 can be used to generate single-copy insertions in C. elegans Chromosome X. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
ESC254 dao-5(cse254[GFP::dao-5]) I. GFP tag inserted into the N-terminus of endogenous dao-5 locus. maintain at 16-20C. Nucleolar GFP expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC770 nucl-1(cse770[nucl-1::mKate2]) IV. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Maintain at 16-20C. Nucleolar mKate2 expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC794 wrdSi23 cse772 [AID*::GFP::rpoa-2] I; nucl-1(cse770[nucl-1::mKate2]) IV. wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC795 ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC796 wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III. wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC797 wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III; nucl-1(cse770[nucl-1::mKate2]) IV. wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
ESC818 wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; set-2(ok952) III. wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
PHX3301 flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
QC162 fat-2(wa17) IV; egl-9(et60) V. egl-9(et60) is a 1670G>A (Arg557His) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC165 fat-2(et63wa17) IV. fat-2(et63) is a 73G>A (Val25Met) substitution mutation and intragenic fat-2(wa17) suppressor. This strain still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC164 fat-2(wa17) IV; egl-9(et62) V. egl-9(et62) is a 1669C>T (Arg557Cys) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC166 fat-2(et64wa17) IV. fat-2(et64) is a 296C>T (Ser99Leu) substitution and intragenic fat-2(wa17) suppressor. This allele still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC169 ftn-2(et67) I; fat-2(wa17) IV. ftn-2(et67) is a 267G>A (Trp89*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC170 ftn-2(et68) I; fat-2(wa17) IV. ftn-2(et68) is a 409C>T (Gln137*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
QC171 fat-2(wa17) IV; hif-1(et69) V. hif-1(et69) is a 1241-1G>A splice acceptor variant and gain-of-function allele that acts as a suppressor of the fat-2(wa17) growth defects. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
RG3523 F21D5.4&F21D5.5(ve1023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATCTTGTAAAGTTTTTCGTGTTCTTCCA ; Right flanking sequence: TGGAAAAATCAGACtttagttttttttAAT. F21D5.4 & F21D5.5 crRNA A: TTTCCGCCCGAAATTCGAAG; F21D5.4 & F21D5.5 crRNA B: TCATCAAATCGCCGTTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3524 faah-5(ve1024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 5065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atcaaatcgtaatgggacagcatggcacca ; Right flanking sequence: AGGTACGATTTTGTGTTAATTCCTTGGAAA. faah-5 crRNA A: ATTTCCTCTTATAACCcacg; faah-5 crRNA B: TTATTCGAGTGGGCAATTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3522 C35C5.10(ve1022[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 4718 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTATCAACTCGTTACGATAAGAATGACCA ; Right flanking sequence: CTCTATAGTCTCTCGATCTATTGACATTAG. C35C5.10 crRNA A: CTTTTCCCCCTCCCGACAAG; C35C5.10 crRNA B: TTGACGTTGTGACAAAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
UJ2015 rab-3(miz237[4xwrmScarlet11::rab-3b]) II. 4xwrmScarlet11 tag inserted inserted at 5' end of rab-3b locus using CRISPR/Cas9. Insertion confirmed by sequencing. wrmScarlet11::RAB-3B shows smaller RAB-3 puncta compared to over-expression reporters. The fusion protein is likely non-functional as the strain shows strong aldicarb resistance; however, the localization pattern of 4×wrmScarlet::RAB-3 is similar to that of transgenically expressed RAB-3. 4×wrmScarlet11::rab-3b strain also labels rab-3a; it is possible that 4×wrmScarlet11 inserted in the middle of rab-3a isoform disrupts the functions of RAB-3 in neurotransmission. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3045 rimb-1(miz458[7xGFP11::rimb-1]) III. 7xGFP11 tag inserted into 5' end of endogenous rimb-1 locus using CRISPR/Cas9. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
PHX11029 asp-1(syb11029[myo-2p::mCherry::unc-54 3'UTR]) V. syb11029 is a replacement of the asp-1 locus, removing the entire coding sequence and inserting the myo-2p::mCherry reporter. Upstream flanking sequence: tccttcttccaggta. Downstream flanking sequence: gtaggaatggtgtttt. Guide sequences: Sg1:ccaggtaATGCAGACCTTCGTTT Sg2:TTCGCCACCGCCGTCCACAAGGG.
RG3526 glct-2(ve1026[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 2023 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACGGTCGAAAAGCTTCAATCCCTCACCT ; Right flanking sequence: GGTGGATTTGTCTAACCGAAAATTCACAAC. glct-2 crRNA A: GGTTTCAGAACACTCATCGT; glct-2 crRNA B: ATTCTGATTGTCCATTcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3527 maph-1.2(ve1027[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 4123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAATAAATTTACTCGGGGGGAAAAATAA ; Right flanking sequence: TGGAAGCTAGTATTTCTGGTTATTTTTAGA. maph-1.2 crRNA A: TAAATAAGTTATGCgggggg; maph-1.2 crRNA B: AATCAATACGCCACTTCTAT. [NOTE: maph-1.2 shares sequence identity with other loci on LGIII and LGIV. Classical genetic mapping was performed confirm the location of the INDEL in LGI.] Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3525 K07C5.3(ve1025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2359 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGTTCTCAGAATGGGAAAGATCATGCCG ; Right flanking sequence: GGGATTGAACTTTTACAATTTTAACTTTCA. K07C5.3 crRNA A: TTTGCAGCCACGAAGAAGTT; K07C5.3 crRNA B: ATGCTCTGAGAAGTTATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3528 pqn-15(ve1028[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 8422 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCTCCTGACTGGGCATATTGAACTTAACA ; Right flanking sequence: CGGCTGAATTTGGTGTGGTCGCTGCACATT. pqn-15 crRNA A: TTCAACTTGAGTTTGATCGG; pqn-15 crRNA B: ATGACCCGATGTGGACCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3529 cpr-2(ve1029[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1827 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTCAACTTTAACCAACTTTGACTTCTCT ; Right flanking sequence: ACAACTGTTTCACGGTGCAATTTcacaggg. cpr-2 crRNA A: GGATGGCAGTTAGAACGTGG; cpr-2 crRNA B: ATATTTGGCACGACCTCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3531 ZK418.10(ve1031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 2100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAAATAATGAAAAAAATACAGTAATACAA ; Right flanking sequence: TGGCTCTATTTTTTGGAGTTGATATACATA. ZK418.10 crRNA A: TGAAATTCAGGGAACGTGAG; ZK418.10 crRNA B: TACACCATAGATTTTCAACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3534 pigq-1(ve1034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTTTAATTTTCACGAAAAGATGTTATT ; Right flanking sequence: TGGACTGTATTAATTGAACTACCCAATTGA. pigq-1 crRNA A: TTTCAATCAAGCTTCCCATT; pigq-1 crRNA B: AACGGTAAAACGAGCGAGGG. Note:The crRNA B target is in the predicted 3' UTR of an allele of F01G4.6. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3532 K11H3.3(ve1032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1276 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTATGAGCGCCTTGACGTGTTCGTCATCCG ; Right flanking sequence: AGTTGCTGGAGCTGCTTCTGTTTATGGAAA. K11H3.3 crRNA A: GATGTGAGGAGAAAGACGGC; K11H3.3 crRNA B: GCTCCCATAAGTCCGACGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PMD300 nhr-49(syb9651[sfGFP::NHR-49c]) I. sfGFP tag inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX9542. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.
PMD342 nhr-49(syb5674[nhr-49::mCherry]) I. mCherry tag inserted at the C-terminus of the endogenous NHR-49 locus. Derived by out-crossing parental strain PHX5674. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.
PMD320 nhr-49(syb10203[3xHA::TurboID::nhr-49c]) I. 3xHA::TurboID tag with GGCG linker sequence inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX10203. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.
MD5019 ced-9(dx236[mNeonGreen::ced-9]) III. mNeonGreen tag inserted at N-terminus of endogenous ced-9 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673. .
MD5018 ced-4(dx226[ced-4::mNeonGreen]) III. mNeonGreen tag inserted at C-terminus of endogenous ced-4 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
MD5017 ced-3(dx228[ced-3::mNeonGreen]) IV. mNeonGreen tag inserted at C-terminus of endogenous ced-3 locus. Generated in N2 background. Reference: Lambie EJ, et al. Cell Death Differ. 2025 Aug 27. doi: 10.1038/s41418-025-01567-8. PMID: 40866673.
SOL19 ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs669 him-5(e1490) V; otDf1 X. NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.
RG3294 clec-57(ve794[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1424bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGATTCTTCTCCCCATTTTCCTGCTTTTCA ; Right flanking sequence: GGGGATTTGAATCGTCTACAAACATGATGA. clec-57 crRNA A: GCATTATTGGACTTTCAGgt; clec-57 crRNA B: ATCTTCATACAATTTGGCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3535 kmo-2(ve1035[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2140 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACAGATATTACTGCATAGCAGCAGAACCG ; Right flanking sequence: AAAAAACACGCATTCGCAGATCCAACAAGA. kmo-2 crRNA A: TAGTGCACACTCAGACCGGT; kmo-2 crRNA B: TGGACAGAAGGGATGGATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3530 tol-1(ve1030[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 17737bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested malformed larvae (ve1030 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACCCAACTGACCATTCACCCGTCTCCTCCT; Right flanking sequence: CGGACAGATTCTACGGAAGCACACGAGAAT. tol-1 crRNA A: GGTGGTTGTTGTAGAGGGGG; tol-1 crRNA B: AATCTGCTGGACGATGAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3533 mrps-34(ve1033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1120 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1033 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAACCTGAGTTTATTTACGCAAATTCGCCA; Right flanking sequence: CGGAGTTGTGAGAGAATCTCGAACAAAAAC. mrps-34 crRNA A: AGAAACGAACCAAACATCAG; mrps-34 crRNA B: CAGCAGAATAACATACGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
PS10686 nas-22(sy2303) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nas-22. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTTTATTCTTCTCTCAATTTTACAAGAGTGCTATG. right flanking sequence: GAAAGGATATTGTTGCAAGAATTGGTGGAAGAAATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTACAAGAGTGCTATGGAA. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616