| MCJ677 |
nsun-2(cdb460[nsun-2::3xFLAG::AID*]) I; ieSi57 II; ieSi38 IV. |
3xFLAG tag and AID* degron inserted at C-terminus of endogenous nsun-2 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: TCCAGAATCTGCTGAAACTC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ133 |
alg-2(cdb12 cdb51[3xFLAG::alg-2]) II. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. sgRNA #1: TCGTCTTTCATGCCAGATGG; sgRNA #2: AAGTGCAGACATACTTAAGT; sgRNA #3: GCTACCATAGGCACCACGAG; sgRNA #4: GCTACCATAGGCACCACGAG. sgRNA #4 was used both for co-CRISPR to mark jackpot founder plates and for modification of cdb12, an edit that introduced a site editable by this gRNA. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ288 |
alg-2(cdb155[D627A]) II. |
cdb155 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ511 |
mir-72(cdb223) II; mir-63(cdb218) X. |
Deletion allele of each microRNA with an efficient CRISPR protospacer sequence (TGTATCAGTTCGATATCTGA) inserted at each locus to facilitate subsequent CRISPR modification. sgRNA #1: GTTGCTCCAGGAGCATGGTT; sgRNA #2: CTGAAGCGAGTTGGAAATAG; sgRNA #3: CTGAAGGTCCCGTCAGAGCT; sgRNA #4: CAGGTCCTCACATCAGTGCG; sgRNA #5: GCTACCATAGGCACCACGAG. sgRNA #5 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ583 |
alg-1(cdb153[D740A]) X. |
cdb153 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ624 |
alg-1(xk5[3xFLAG::alg-1] cdb358[D740A]) X. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. cdb358 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ639 |
alg-2(cdb12 cdb51[3xFLAG::alg-2] cdb370[D627A]) II. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. cdb370 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| QK67 |
alg-1(xk5[3xFLAG::alg-1]) X. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| RG3544 |
pigc-1(ve1044[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 933 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1044 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAAATAATGACAGAAAACAGAATATTGTCG; Right flanking sequence: TGGTGTTGCCATTTGGCGAACGCATAACCT. pigc-1 crRNA A: AGGAAAGGCAAGGATACACG; pigc-1 crRNA B: AATATCTTCTGCCAACCCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3548 |
+/nT1 [umnIs49] IV; scpl-4(ve1048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 2742 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1048 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TATTTCTCATTATACAAAAATTTCAGATTT; Right flanking sequence: CGGTATATGACAGTTGAATTCTCCGTCTAC. scpl-4 crRNA A: TAAATCTCTTCTGGGCCCAC; scpl-4 crRNA B: ACACTAGAGTTGTTCAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
