| PS10501 |
pam-1(sy2224) IV. |
Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| PS10497 |
gst-25(sy2221) I. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gst-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGACTTATCAAAATGACCCTTAAATTCTCCTACT. right flanking sequence: TTGGAACCCGCGGTATCGGTGAGCCGATTCGTATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATACCGCGGGTTCCAAAGT. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| SSR1578 |
ssrIs1248. |
ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215 |
| SSR1605 |
ssrIs1251. |
ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215 |
| ZM5842 |
hpIs228. |
hpIs228 [rgef-1p::GFP::FUS[R522G] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| ZM5844 |
hpIs233. |
hpIs233 [rgef-1p::GFP::FUS[P525L] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| AMJ912 |
jamSi28 II; rde-4(ne301) III. |
jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563. |
| AMJ565 |
jamSi6 II; rde-4(ne301) III. |
jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563. |
| RG3537 |
semi-1(ve1037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 2957 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaaAATGATGGGCACGAGTACCATGAAGA ; Right flanking sequence: AGGTCGTTCTTCTGGTTTCATAAATTTTGA. semi-1 crRNA A: GGAACAGATTAATTTAgggg; semi-1 crRNA B: TGATGTTCTACAGCCATTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3538 |
ZK1240.8(ve1038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTAATCCTCTTTTCCCTTTCATCAACCA ; Right flanking sequence: ATTAGATAACAAAATAGATTAGTAAGAGTA. ZK1240.8 crRNA A: TTTCAGTAGAATCCGTCAAT; ZK1240.8 crRNA B: GCTCCTTTAGTGACATGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| ZM5838 |
hpIs223. |
hpIs223 [rgef-1p::GFP::FUS + lin-15(+)]. GFP expression in neurons. Essentially wild-type movement; slight difference compared to N2 animals. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| MD5004 |
drp-1(dx230[drp-1::mNeonGreen]) IV. |
mNeonGreen tag inserted into the variable region of endogenous drp-1 locus (internal tag). N- and C-terminal fusions of DRP-1 cause a block in mitochondrial fission (acting as dominant-negatives), whereas internally-tagged DRP-1 protein has close to wild-type activity. Generated in N2 background. Reference: Lambie EJ & Conradt B. MicroPubl Biol. 2025 May 8;2025:10.17912/micropub.biology.001588. PMID: 40415901. |
| MD5016 |
egl-1(dx243[mSG::egl-1]) V. |
Coding sequence for monomeric StayGold (mSG) inserted at the beginning of the 2nd exon of the endogenous egl-1 locus. mSG::EGL-1 retains close to wild-type activity (0.3 extra cells in the anterior pharynx compared to 11.9 extra cells for egl-1(n1084 n3082)). |
| RG3539 |
R74.7(ve1039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1268 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCATTCTCTGGACGAATTCATGCAAGCCG ; Right flanking sequence: TCTCTAAACCTCTTCTGTTTTCTCTTCACA. R74.7 crRNA A: GAAGGCAGCGAGGATTAGTT; R74.7 crRNA B: AAAATGCGAGGGACAGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3542 |
bgnt-1.7(ve1042[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 1979 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGGAAATTTTCAAATCGTAAAAGGTCCA ; Right flanking sequence: CGGGTTTTCCTCTTGTTCTCCATAAACACC. bgnt-1.7 crRNA A: CCAGACACTACAACAAGATG; bgnt-1.7 crRNA B: TTTTGAGAAGCTGCGCCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| ERT529 |
unc-119(ed3) III; jySi40. |
jySi40 [vha-6p::NANOLUC::3xFLAG::unc-54 3' UTR + Cbr-unc-119(+)]. Can be used as a Nanoluciferase (NanoLuc) expressing control for luminescence in Promega NanoGlow Assays. Reference: Sfarcic I, et al. Genetics. 2019 Dec;213(4):1197-1207. doi: 10.1534/genetics.119.302655. PMID: 31585955. |
| GS10011 |
arTi479 [unc-47p::cre::unc-54 3'UTR] I. |
miniMOS insertion expressing cre recombinase specifically in GABAergic neurons. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH18562 |
unc-119(ed3) III; otIs898[*oxTi553] V. |
otIs898 [pha-4prom2::3xNLS::ceGCaMP6s::unc-54 3' UTR]. Neuron-specific cis regulatory fragment of pha-4 driving expression of C. elegans codon-optimized GCaMP6s in enteric neurons. The multicopy array was inserted at the oxTi553 landing site (EG7944) by FLInt. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH19864 |
fog-29(q71) pha-4(ot1506)/stu-3(q265) rol-9(sc148) V. |
Heterozygous. Pick wild-type to maintain. ot1506 is a full (6665bp) deletion of the pha-4 locus coding region from the start codon of the longest isoform to the stop codon. Heterozygotes appear wild-type, and segregate wild-type heterozygotes, fog-29(q71) pha-4(ot1506) homozygotes (arrest as embryos or L1s), Sterile Rollers. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH19945 |
pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. |
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH18512 |
pha-1(e2123) III; otEx8085. |
otEx8085 [pha-4(prom2)::GFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to select for animals carrying the array. pha-4 cis-regulatory element drives expression specifically in all 20 pharyngeal enteric neurons, 2 hindgut enteric neurons, as well as RIS and PVT. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20089 |
otEx8333. |
otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20099 |
pha-4(ot1078[loxp::pha-4::GFP::loxP] *ot946) V; otEx8343. |
otEx8343 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of pha-4 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| OH20095 |
egl-3(nu1711[loxP::egl-3::loxP]) V; otEx8339. |
otEx8339 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of egl-3 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
| RG3541 |
+/mT1 [umnIs52] II; spe-21(ve1041[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3545 |
F47B8.10(ve1045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCTTATCTGTTTCCTTCTTCTCATCCCA ; Right flanking sequence: ATTGTTTTATGAAATTAAAGCAAATAAAAT. F47B8.10 crRNA A: ACAAAATCGTACATTGTGGG; F47B8.10 crRNA B: TCAAAAAATGCAGTTCGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3543 |
tsct-2(ve1043[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Sterile. Deletion of 9001 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, sterile GFP+ non-mKate2 (ve1043 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAGAATAAGGAGAAGAAGCAACAAGTACCG; Right flanking sequence: CGGGTAGCTAACTAAAATGTGAAGAGCTAT. Y48C3A.12 sgRNA A: GGTGTATTCATCGGTGTCGG; Y48C3A.12 sgRNA B: TCCCCCGTCCAAACCACGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3540 |
+/mT1 [umnIs52] II; rps-14(ve1040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 921 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve1040 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: agctgagccttcgatctgaacaaactccca; Right flanking sequence: tggaaaaagtcgctacgcagccaatggtct. rps-14 crRNA A: atagttaagtatgctctggc; rps-14 crRNA B: ttggctgcgtatcatttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3536 |
nuaf-3(ve1036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1840 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1036 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATTTCTGAGCAGTTCATCAAAAAATACGA; Right flanking sequence: CGGAAAAGCTGCAGAATTGTCATAGCCTGA. nuaf-3 crRNA A: TAGGAGGAGGAGATGCGAAT; nuaf-3 crRNA B: GATGCCAGTGTACAGAGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3546 |
Y43E12A.2(ve1046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACACCTTATTATTAAAATAGTATTGCCCT ; Right flanking sequence: GATATCACGTCGTCATTGATTTTATTGACA. Y43E12A.2 crRNA A: GGAGAAAAGCAAGGGAAAAA; Y43E12A.2 crRNA B: TCTTCGTGTTTCCGTGCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3547 |
W01B6.3(ve1047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2025bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGTGTTTGAAACAACTGTTTTGTTTACCT ; Right flanking sequence: AGGGCAGTTTTGCATAGTTTCCGTCTCATT. W01B6.3 crRNA A: AATCATTGGCCCGAGAAAAC; W01B6.3 crRNA B: GTGGATTAGGCAAATGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| TAM93 |
pash-1(ram33[G179R]) I. |
Maintain at 15C. Low penetrance protruding vulva and bursting at permissive temperatures. pash-1(ram33[G179R]) is a G754A substitution (relative to the start codon in T22A3.5A.1) that results in a G179R substitution in the PASH-1 WW domain. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566. |
| TAM94 |
pash-1(syb4327[W180A]) I. |
Maintain at 15C. Reduced brood size. Low penetrance protruding vulva and bursting. Temperature sensitive-sterility. pash-1(syb4327[W180A]) is a TGG to GCA substitution at position 756 (relative to the start codon in T22A3.5A.1) that results in a W180A substitution in the PASH-1 WW domain. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566. |
| TAM95 |
drsh-1(syb6628[mCherry::drsh-1]) pash-1(syb6091[pash-1::GFP]) I. |
mCherry tag inserted inserted directly after start codon of endogenous drsh-1 locus. GFP tag inserted directly before the stop codon of endogenous pash-1 locus. Fluorescence enriched in nuclei of embryos and germ cells. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566. |
| TAM109 |
ramTi3 II. |
ramTi3 [ubl-1::mCherry::pri-mir-58 + Cbr-unc-119(+)] II. mCherry-based sensor for pri-miR-58 processing. Weak ubiquitous mCherry fluorescence. MosSCI insertion. Previously described as ram3. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566. |
| WRM113 |
mex-3(spr37) I. |
Homozygous fertile, reduced brood at 25C. mex-3(spr37) is a CRISPR/Cas9 engineered indel removing nucleotides 28-651 of the mex-3 3’ UTR and inserting the sequence 5’-TTCATTCCAATT-3’ between break points. Displays temperature-sensitive embryonic lethality phenotype at 25C seen in other mex-3 3’ UTR deletion strains, though less penetrate than observed in GFP-tagged mutants. Derived in N2 background. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM75 |
mex-3(spr9[*tn1753]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. |
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains WRM52 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM77 |
mex-3(tn1753[gfp::3xflag::mex-3]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. |
Homozygous fertile. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains DG4269 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM79 |
mex-3(spr9[*tn1753]) I; sprSi1 II; unc-119(ed3) III. |
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains WRM52 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM80 |
mex-3(tn1753[gfp::3xflag::mex-3]) I; sprSi1 II; unc-119(ed3) III. |
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Homozygous fertile. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains DG4269 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM81 |
mex-3(spr9[*tn1753]) I; pgl-1(spr20[mCherry::pgl-1]) IV. |
Homozygous fertile, reduced brood at 25C. mCherry tag inserted at N-terminus of endogenous pgl-1locus in parental strain WRM52. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Homozygous fertile; reduced brood size. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| WRM82 |
mex-3(tn1753[gfp::3xflag::mex-3]) I; pgl-1(spr20[mCherry::pgl-1] IV. |
mCherry tag inserted at N-terminus of endogenous pgl-1locus in parental strain DG4269. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769. |
| RG5108 |
Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5290 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4205 and CGC51. gk5290 is a deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5109 |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5110 |
perm-1(gk5785[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4716 and CGC66. gk5785 is a deletion of 1919 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGGAAATCTGTTTTAAAAATGTTTGCCCG. Right flanking sequence: TTTTCCAATAATCCAATACCCATTTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5111 |
+/mT1 [umnIs52] II; wah-1(gk5392[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5392 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4309 and CGC66. gk5392 is a deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| MCJ366 |
mir-4812(cdb175) mir-1829b(cdb163) mir-1829c(cdb164) mir-1829a(cbd199) X. |
Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ387 |
ieSi57 II; dcr-1(zen79[dcr-1::AID*::3xFLAG]) III; ieSi38 IV. |
AID* degron and 3xFLAG tag inserted at C-terminus of endogenous dcr-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. sgRNA #1: CCTCTTCACTTTCTGTGATATGC. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ474 |
gldr-2(cdb217[3xFLAG::AID*::GFP::gldr-2]) I. |
3xFLAG::AID*::GFP degron tag inserted at N-terminus of endogenous gldr-2 locus. sgRNA #1: TTTCTCGACATttctgaaag; sgRNA #2: CACATTCATGGGAACTGAAT; sgRNA #3: GCTACCATAGGCACCACGAG. sgRNA #3 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ666 |
ieSi57 II; rpc-1(cdb434[rpc-1::3xFLAG::AID*]) ieSi38 IV. |
3xFLAG tag and AID* degron inserted at C-terminus of endogenous rpc-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: CGGCGAATTCTGTTTAAGAA; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
