Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
ERT781 drh-1(jy110) IV. jy110 is a CRISPR-engineered deletion removing the entire drh-1 coding sequence. Susceptible to viral infection. Defective in inducing the intracellular pathogen response upon viral infection. Reference: Sowa JN, et al. J Virol. 2020 Jan 6;94(2):e01173-19. doi: 10.1128/JVI.01173-19. PMID: 31619561.
JAZ454 jlgEx220. jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
PHX5406 nep-2(syb5406[GFPnovo2::nep-2]) II. GFPnovo2 inserted at N-terminus of endogenous nep-2 locus. Expression in muscle, including uterine and vulval muscles, as well as several neurons and other tissues. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
JAZ515 nep-2(ok2846) II; jlgEx251. jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
NK3057 emb-9(qy236[emb-9::mNG]) III. mNG tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3026 let-2(qy228[let-2::mNG]) X. mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3072 emb-9(qy244[emb-9::mRuby2]) III. mRuby2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK2984 let-2(qy216[let-2::mRuby2]) X. mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3073 emb-9(qy245[emb-9::mEos2]) III. Photoconvertible mEos2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3242 let-2(qy290[let-2::mMaple]) X. Photoconvertible mMaple tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3237 let-2(qy286[let-2::P2A::PEST::mNG]) X. Endogenous reporter of type IV collagen alpha chain (let-2) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of let-2 and mNG. P2A causes let-2 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3238 emb-9(qy287[emb-9::P2A::PEST::mNG]) III. Endogenous reporter of type IV collagen alpha chain (emb-9) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of emb-9 and mNG. P2A causes emb-9 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3240 emb-9(qy288[emb-9 (G1173D)::mNG]) III. Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
NK3241 let-2(qy289[let-2 (G1287D)::mNG]) X. Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
RG3501 F58G1.2(ve1001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Sterile. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve1001 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TATTGTAAACATTAAAATGTGGGAAAACTG; Right flanking sequence: TCCTGATTGTTCCTGTAATTAATTGCATTA. F58G1.2 crRNA A: GGTGAAATCGTCATTGAACG; F58G1.2 crRNA B: CAAGCAACGAGAAACAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3502 madf-11(ve1002[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3503 ears-1(ve1003[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 3574 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1003 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGATGCTGTCACGAAGAATGACTATTCCCT; Right flanking sequence: GGGGATACACTTTCCAAGCAGATTGATGAT. ears-1 crRNA A: GAAAATCCTTTCCCAAAAGG; ears-1 crRNA B: CAGCTCCATCGGTCTCCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3504 gars-1(ve1004[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1004 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: TGTAACTCATCTCAAAGCGTGAGAGTTCCT; Right flanking sequence: ATCATAGAAGAATCGTCTTTTGAGAAGATC. gars-1 crRNA A: AGTTATGGATGCCGTTAAGG; gars-1 crRNA B: CAATCATTTGCTATCTATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3494 +/mT1 [umnIs52] II; pars-1(ve994[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval lethal. Deletion of 1632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve994 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGAGATCGAGGAGCAAGGAGCCGAAGTCCG; Right flanking sequence: TCAAATCTCTTCTTGATGAAATTCATACTG. pars-1 crRNA A: TCTTGTCACCTTTCACACGG; pars-1 crRNA B: CAGTTTTAGACAGTCCTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3491 rps-24(ve991[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV/dpy-9(tm9713) kvs-5(tmIs1245) IV. tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested larvae (ve991 homozygotes),Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain . Left flanking Sequence: aattttaaaactacaattcaaatttatttt; Right flanking sequence: AGACTCGTTCGCgtaagttacttttctgaa. rps-24 crRNA A: gcaggtaatattcatcacgA; rps-24 crRNA B: GTACTTCGGCTCAAACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3505 tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3493 rars-1(ve993[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3506 +/nT1 [umnIs49] IV; sqv-4(ve1006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve1006 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATCGTAGACTGATAATTTTGCATGCTCCT; Right flanking sequence: tacaatgcagaatatgcacaataaatgacg. sqv-4 crRNA A: CGTAATCAAACACTTGATGG; sqv-4 crRNA B: cgagttgattttctgtaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RHS191 uthSi17 I. uthSi17 [myo-3p::MLS::GFP::unc-54 3’UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses myo-3 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in body-wall muscle cells. Derived by out-crossing parental strain AGD1664 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
RHS192 uthSi83 I. uthSi83 [col-19p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses col-19 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in hypodermal cells beginning in late L4 stage. Derived by out-crossing parental strain AGD2837 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
RHS193 uthSi80 IV. uthSi80 [vha-6p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single-copy insertion. MLS::GFP reporter uses vha-6 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in intestinal cells. Derived by out-crossing parental strain AGD2805 (EG6703 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.
NK3236 qySi252 [let-2p::mNG] I. qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
PHX7929 srx-9(syb7929[srx-9::SL2::FLP D5]) V. FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX9007 unc-4(syb9007[unc-4::SL2::FLP D5]) II. FLP D5 recombinase driver expressed from the unc-4 locus. unc-4::SL2::FLP causes recombination specifically in Dorsal A-type motor neurons, SABs neurons and I5. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX8127 srm-1(syb8127[unc-25p(fragment)::SL1-aaaa::FLP D5::let-858 3’UTR]) IV. srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX8025 nmr-1(syb8025[nmr-1::SL2::FLP D5]) II. FLP D5 recombinase driver expressed from the nmr-1 locus. nmr-1::SL2::FLP causes recombination in command interneurons including AVA, AVD, AVE, RIM, AVG, PVCs. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6265 lgc-38(syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]) III. (III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6333 dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX2457 dmsr-7(syb2457) V. Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX5866 flp-11(syb5866) X. Molecular null allele. syb5866 is a CRISPR-engineered deletion of the entire flp-11 coding region. Strongly reduces sleep. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
AD309 spe-21(syb4299) III; asEx98. asEx98 [spe-21(+) + myo-3::GFP]. Pick GFP+ animals to maintain. syb(4299) is a non-conditional allele of spe-21. Mutant hermaphrodites and males are severly subfertile. Array carries a fragment (PCR product) of R13F6.5 containing a wild-type copy spe-21(+). spe-21/R13F6.5 formerly known as dhhc-5. The extrachromosomal array effectively rescues the fertility defect. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
AD316 spe-21(syb4179[spe-21::mNG]) III. mNeonGreen tag inserted at the C-terminus of the endogenous spe-21 locus by CRISPR. Expression in the membranous organelles of sperm. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
JDW820 col-159(wrd339)[col-159::linker::mNG::3xFLAG::linker]) V Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-159 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW829 col-10(wrd345[col-10::linker::mNG::3xFLAG::linker (internal)]) V Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 2 of the endogenous col-10 locus by CRISPR which will produce a translational fusion after amino acid 89. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW877 wrt-2(wrd365[linker::mNG::3xFLAG::linker (internal)]) X Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 1 in the endogenous wrt-2 locus by CRISPR; produces a translation fusion after amino acid 18, immediately following the signal peptide.. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
EL488 ekl-1(om83)/unc-15 ccIs4251 I. Heterozygotes are superficially wildtype and express GFP in body wall muscle nuclei. They segregate sterile ekl-1(om83) homozygotes and unc-15(e73) ccIs4251 homozygotes that are severely uncoordinated and GFP+ in body wall muscle nuclei. Pick wild-type GFP+ and check for correct segregation of progeny. The ccIs4251 insertion carries [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)]. Reference: She X, et al. PLoS Genet. 2009 Aug;5(8):e1000624. doi: 10.1371/journal.pgen.1000624. PMID: 19714217.
EL597 omIs1 II; met-2(n4256) unc-119(ed3) III. omIs1 [met-2p::met-2::GFP + Cbr-unc-119(+)] II. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL610 smrc-1(om143[3xflag::smrc-1]) III. 3xFlag tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL680 smrc-1(q136)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP q136 homozygotes (reduced fertility, reduced embryonic viability, and increased frequency of male offspring). q136 is a nonsense mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL630 smrc-1(om138)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om138 homozygotes (reduced fertility, reduced embryonic viability and a high proportion of male offspring). om138 is a frameshift mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL632 smrc-1(om138) met-2(n4256)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP non-GFP smrc-1(om138) met-2(n4256) homozygotes (reduced fertility, reduced embryonic lethality, and produce a high frequency of male offspring). These phenotypes are more severe at 25C, and at 25C the subsequent M-Z- generation produces essentially no viable embryos. The smrc-1(om138) allele was generated with CRISPR/Cas9 on the met-2(n4256) chromosome. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL634 met-2(om142 [3xflag::met-2]) III. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.
EL663 smrc-1(om144[3xmyc::smrc-1]) met-2(om142[3xflag::met-2]) III. 3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL732 smrc-1(om145[3xmyc::smrc-1]) III. 3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL658 smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.