| CZ28766 |
col-19::mNG(syb4625) X. |
mNG inserted at C-terminus of endogenous col-19 locus. Derived by out-crossing parental strain PHX4625 2x to N2. |
| PHX7585 |
col-20::mNG(syb7585) II. |
mNG inserted at C-terminus of endogenous col-20 locus. |
| PHX7608 |
col-43::mNG(syb7608) V. |
mNG inserted at C-terminus of endogenous col-43 locus. |
| PHX7676 |
col-48::mNG(syb7676) I. |
mNG inserted at C-terminus of endogenous col-48 locus. |
| PHX5014 |
col-63::mNG(syb5014) I. |
mNG inserted at C-terminus of endogenous col-63 locus. |
| PHX8144 |
col-71::mNG(syb8144) II. |
mNG inserted at C-terminus of endogenous col-71 locus. |
| PHX7596 |
col-81::mNG(syb7596) II. |
mNG inserted at C-terminus of endogenous col-81 locus. |
| PHX7670 |
col-91::mNG(syb7670) III. |
mNG inserted at C-terminus of endogenous col-91 locus. |
| PHX7695 |
col-93::mNG(syb7695) III. |
mNG inserted at C-terminus of endogenous col-93 locus. |
| PHX7567 |
col-128::mNG(syb7567) IV. |
mNG inserted at C-terminus of endogenous col-128 locus. |
| PHX7565 |
col-174::mNG(syb7565) X. |
mNG inserted at C-terminus of endogenous col-174 locus. |
| PHX8274 |
col-178::mNG(syb8274) X. |
mNG inserted at C-terminus of endogenous col-178 locus. |
| PHX8253 |
dpy-1::mNG(syb8253) III. |
mNG inserted at C-terminus of endogenous dpy-1 locus. |
| PHX4550 |
dpy-2::mNG(syb4550) II. |
mNG inserted at C-terminus of endogenous dpy-2 locus. |
| PHX4583 |
dpy-3::mNG(syb4583) X. |
mNG inserted at C-terminus of endogenous dpy-3 locus. |
| PHX3312 |
dpy-5::mNG(syb3312) I. |
mNG inserted at C-terminus of endogenous dpy-5 locus. |
| PHX3318 |
dpy-13::mNG(syb3318) IV. |
mNG inserted at C-terminus of endogenous dpy-13 locus. |
| PHX5033 |
rol-1::mNG(syb5033) II. |
mNG inserted at C-terminus of endogenous rol-1 locus. |
| OH18619 |
lim-6(ot1391[lim-6::GFP]) X. |
C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| OH18821 |
nlp-18(ot1421[nlp-18::SL2::GFP::H2B]) II. |
SL2::GFP::H2B tag inserted after STOP codon of endogenous nlp-18 locus using CRISPR/Cas9. The 15 first nucleotides of the standard SL2 sequence (immediately downstream of nlp-18 STOP) are missing but bright GFP fluorescence is clearly detectable. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988. |
| AMP101 |
weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) III. |
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368. |
| AMP116 |
weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) glp-1(e2141) III. |
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Maintain at 20C or less. Sterile at 25C. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368. |
| RG3487 |
dhs-20(ve987[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1097 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTGGGATATTATTTTTAAAAAACCCT ; Right flanking sequence: ATTGATAAGGTTTTTTTGTTCTTGATTCTT. dhs-20 sgRNA A: GAGATTGTTAAAGGGTGTCC ; dhs-20 sgRNA B: TGGGTCGACCTTGAACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| DV4326 |
bar-1(ga80) X. |
Variably penetrant Unc, Vul, pVul, Egl, vulval rupture, and slow growth. Parental strain EW15 was outcrossed to separate bar-1(ga80) from a described background PRY-1(N354K) mutation. The phenotypes of the outcrossed strain are much more severe than those of the progenitor strain EW15. |
| PHX6073 |
tol-1(syb6073[Q712A,Y713A,G714A,N715A]) I. |
Reduced brood size; high rates of embryonic and larval arrest. CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| PHX8408 |
lat-1(syb8408[lat-1AAAAA::EGFP::linker::3xFLAG::AAAAA]) II. |
Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| PHX8406 |
tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I. |
WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| PHX8955 |
lat-1(syb8955[lat-1 F69A] *syb8408) II. |
Engineered F69A mutation in endogenously-tagged lat-1 locus. Slightly reduced brood size. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| PHX8810 |
tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I. |
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reduced brood size, high levels of embryonic and larval arrest. syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| KRA867 |
tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)AAAAA::EGFP::linker::3xFLAG::AAAAA]) II. |
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| PHX9026 |
lat-1(syb9026[lat-1(delta Lec)] *syb8408) II. |
CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414. |
| CZ31328 |
efa-6(ju1658[GFP::EFA-6]) IV. |
Endogenous efa-6 locus tagged with GFP using CRISPR/Cas9. GFP is visible under compound fluorescence microscope. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484. |
| CZ29092 |
jsIs973 III; efa-6(*ju1658[GFP::EFA-6] ju1903) IV. |
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484. |
| CZ25941 |
dlk-1(ju1579[gfp::dlk-1]) I. |
Endogenous dlk-1 locus tagged with GFP using CRISPR/Cas9. GFP is not visible under compound fluorescence microscope. Reference: Sun Y, et al. Proc Natl Acad Sci U S A. 2023 Sep 26;120(39):e2302801120. doi: 10.1073/pnas.2302801120. PMID: 37722038. |
| CZ22190 |
rpm-1(ok364) rpms-1(ju1285) V. |
ju1285 is a deletion in F07B7.12/rpms-1. Reference: Sun Y, et al. MicroPubl Biol. 2024 Dec 5;2024:10.17912/micropub.biology.001396. doi: 10.17912/micropub.biology.001396. PMID: 39712931. |
| CZ2060 |
juIs137 II. |
juIs137 [flp-13p::snb-1::GFP] II. GFP expression labels synaptic vesicles. Reference: Sakaguchi-Nakashima A, et al. Curr Biol. 2007 Apr 3;17(7):592-8. doi: 10.1016/j.cub.2007.01.074. PMID: 17346966. |
| BU8041 |
pat-3(kq8041) III. |
Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291 |
| CVB96 |
siss-1(csn20) IV. |
siss-1(csn20) animals are defective in stress-induced sleep (SIS) with no other obvious defects in development or behavior. csn20 is a Cys-to-Tyr substitution in the third Cys residue of the EGF motif of SISS-1 (a.k.a. IGEG-1). csn20 phenocopies the deletion allele ve532, indicating that the EGF domain of SISS-1 is functional. Reference: Hill AJ, et al. Nat Commun 15, 10886. doi: 10.1038/s41467-024-55252-4. PMID: 39738055. |
| ZM8202 |
ubr-1(hp821 hp833) I. |
Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217. |
| ZM9040 |
unc-2(hp647) X. |
Hyperactive. Frequent alternation between forward and backward locomotion (shuttling). hp647 is a is a gain-of-function mutation identified as a suppressor of the 'fainter' motor defects of unc-80(e1069) mutants. Reference: Gao S, Elife. 2018 Jan 23:7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM6610 |
nlf-1(hp428) X. |
Fainter. hp428 is a G to A substitution that alters the 3′ splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043. |
| ZM1079 |
unc-77(hp102) IV. |
Hyperactive coiler. hp102 is a gain-of-function mutation. Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069. |
| ZM3360 |
unc-77(hp102) IV; unc-80(hp369) V. |
Fainter. hp369 is an early nonsense mutation in unc-80 and was isolated as a suppressor of unc-77(hp102). Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069. |
| RG3486 |
rps-15A(ve986[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3488 |
rps-26(ve988[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [umnIs78] I. |
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve988 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: ggtacaATGACGTTCAAGAGACGTAACCAC; Right flanking sequence: tttgaaattataaacctttttgttgcaatc. rps-26 crRNA A: GGAAGAAACAAGAAGAACCG; rps-26 crRNA B: gaacaaacaacTTATGGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| OH19118 |
otIs913 V. |
otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3’ UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX5462 |
ins-18(syb5462[ins-18::SL2::GFP::his-44]) I. |
SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18320 |
ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. |
ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| OH18508 |
daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. |
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| PHX5424 |
ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. |
SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
