Search Strains

More Fields
Strain Species Genotype Add
CF4586 C. elegans muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4594 C. elegans muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4601 C. elegans muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4608 C. elegans muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4611 C. elegans muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4614 C. elegans muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4616 C. elegans muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4625 C. elegans muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4639 C. elegans glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
RSL123 C. elegans dpy-10(cn64) rab-3(ftw79) II. Show Description
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL94 C. elegans unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL98 C. elegans muIs252 II; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL99 C. elegans muIs257 I; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
UJ2015 C. elegans rab-3(miz237[4xwrmScarlet11::rab-3b]) II. Show Description
4xwrmScarlet11 tag inserted inserted at 5' end of rab-3b locus using CRISPR/Cas9. Insertion confirmed by sequencing. wrmScarlet11::RAB-3B shows smaller RAB-3 puncta compared to over-expression reporters. The fusion protein is likely non-functional as the strain shows strong aldicarb resistance; however, the localization pattern of 4×wrmScarlet::RAB-3 is similar to that of transgenically expressed RAB-3. 4×wrmScarlet11::rab-3b strain also labels rab-3a; it is possible that 4×wrmScarlet11 inserted in the middle of rab-3a isoform disrupts the functions of RAB-3 in neurotransmission. Reference: Kurashina M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3233 C. elegans cla-1(miz378[cla-1::8xwrmScarlet11]) IV. Show Description
8xmScarlet11 tag inserted into endogenous cla-1 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
UJ3321 C. elegans syd-2(miz329 [8xwrmScarlet11::syd-2]) X. Show Description
8xwrmScarlet11 tag inserted at 5' end of endogenous syd-2 locus. Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.