| ENL59 |
C. elegans |
sma-10(ok2224) IV; dbl-1(nk3) V. Show Description
Derived from RB1739 and NU3.
|
|
| ENL61 |
C. elegans |
mir-58.1(n4640) IV; dbl-1(nk3) V. Show Description
Small. Derived from MT15024 and NU3.
|
|
| NU3 |
C. elegans |
dbl-1(nk3) V. Show Description
Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4.
|
|
| NK3017 |
C. elegans |
fce-1(qy215[mNG::fce-1]) I. Show Description
fce-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3018 |
C. elegans |
mtx-1(qy217[mtx-1::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous mtx-1 locus. Insertion verified by PCR. Left flanking sequence: 5' ATGGAATTACACATTTGGCCG 3' ; Right flanking sequence: 5' TGTTGAGGATCTTTCTTCCT 3'. sgRNA: 5' GACTGACACTTGAATCAGACA 3'.
|
|
| NK3019 |
C. elegans |
qySi218[rpl-28p::tomm-20::mKate2::3xHA::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous expression of red mitochondria outermembrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3026 |
C. elegans |
let-2(qy228[let-2::mNG]) X. Show Description
mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3027 |
C. elegans |
qySi148 I; lam-2(qy20[lam-2::mNG]) IV. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3030 |
C. elegans |
qySi229 I. Show Description
qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3047 |
C. elegans |
immt-1(qy230[immt-1::mNG]) X Show Description
mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. Insertion verified by PCR. Left flanking sequence: 5' GTCAATCCAGAAGACGAGTT 3' ; Right flanking sequence: 5' ATCGATGAGAACGGAGGAAC 3'. sgRNA: 5' CTAATAAGTTGAGCGAATCG 3'.
|
|
| NK3055 |
C. elegans |
qySi147 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi147 [lin-29p::mKate2::PLC(delta)PH] I. qy234 [mNG::sec16A.1] III. sec16A.1 locus endogenously tagged with mNG at the N-terminus and MosSCI single copy insertion for anchor cell specific expression of membrane marker PLC?PH. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3057 |
C. elegans |
emb-9(qy236[emb-9::mNG]) III. Show Description
mNG tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3065 |
C. elegans |
qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3066 |
C. elegans |
rrf-3(pk1426) II; qyIs221. Show Description
qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3072 |
C. elegans |
emb-9(qy244[emb-9::mRuby2]) III. Show Description
mRuby2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3073 |
C. elegans |
emb-9(qy245[emb-9::mEos2]) III. Show Description
Photoconvertible mEos2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3080 |
C. elegans |
cpIs91 II; sbp-1(qy94[mNG::sbp-1]) III. Show Description
cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3084 |
C. elegans |
mtx-2(qy248[mNG::mtx-2]) III. Show Description
mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus. Insertion verified by PCR. Left flanking sequence: 5' CTACAATTTGCCTGCCGATGA 3' ; Right flanking sequence: 5' TACCTCGACAGTGGTAAGAA 3'. sgRNA: 5' GACCAATTGGGTTATCACCC 3'.
|
|
| NK3085 |
C. elegans |
cpIs91 II; immt-1(qy230[immt-1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3086 |
C. elegans |
cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3087 |
C. elegans |
cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3114 |
C. elegans |
crls-1(qy255[crls-1::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. Insertion verified by PCR. Left flanking sequence: 5' AGTCACTACCACCGGAAGAACG 3' ; Right flanking sequence: 5' CTTGGTTTCGGCACTGGTGTTTC 3'. sgRNA: 5' CGGGACTACAGTATGCCAGTAA 3'.
|
|
| NK3189 |
C. elegans |
qySi275 I. Show Description
qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| NK3210 |
C. elegans |
nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus.
|
|
| NK3211 |
C. elegans |
nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.
|
|
| NK3212 |
C. elegans |
cox-4(qy134[cox-4::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-4 locus. Insertion verified by PCR. Left flanking sequence: 5' CACGAAGAGAGAACGGTTTTTGA 3' ; Right flanking sequence: 5' TCGACTGGAAACTCTCGAAGGT 3'. sgRNA: 5' TTCTCGTAATCGTAGTGTGT 3'. Superficially wild-type.
|
|
| NK3229 |
C. elegans |
unc-119(ed4) III; qyIs629. Show Description
qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR.
|
|
| NK3234 |
C. elegans |
cpIs91 II; crls-1(qy255[crls-1::mNG]) III. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3236 |
C. elegans |
qySi252 [let-2p::mNG] I. Show Description
qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3237 |
C. elegans |
let-2(qy286[let-2::P2A::PEST::mNG]) X. Show Description
Endogenous reporter of type IV collagen alpha chain (let-2) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of let-2 and mNG. P2A causes let-2 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3238 |
C. elegans |
emb-9(qy287[emb-9::P2A::PEST::mNG]) III. Show Description
Endogenous reporter of type IV collagen alpha chain (emb-9) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of emb-9 and mNG. P2A causes emb-9 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3240 |
C. elegans |
emb-9(qy288[emb-9 (G1173D)::mNG]) III. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3241 |
C. elegans |
let-2(qy289[let-2 (G1287D)::mNG]) X. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3242 |
C. elegans |
let-2(qy290[let-2::mMaple]) X. Show Description
Photoconvertible mMaple tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3255 |
C. elegans |
mtx-2(qy248[mNG::mtx-2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus in netrin null mutant background (ev400).
|
|
| NK3271 |
C. elegans |
qySi296 I. Show Description
qySi296 [eef-1A.1p::SL2::HYlight::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor HYlight inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3281 |
C. elegans |
unc-119(ed4) III; unc-6(ev400) X; qyIs552. Show Description
qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400).
|
|
| NK3299 |
C. elegans |
qySi312 I. Show Description
qySi312 [eef-1A.1p::SL2::HYlight-RA::tbb-2 3'UTR] I. Ubiquitous somatic expression of glycolysis ratiometric biosensor Hylight-reduced affinity (RA) control inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3304 |
C. elegans |
qySi313 I; unc-119(ed4) III; qyIs629. Show Description
qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3306 |
C. elegans |
unc-119(ed4) III; unc-6(ev400) X; qyIs636. Show Description
qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).
|
|
| NK3314 |
C. elegans |
qySi148 I; unc-119(ed4) III; qyIs636. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3325 |
C. elegans |
qySi316 I. Show Description
qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
|
|
| NK358 |
C. elegans |
unc-119(ed4) III; qyIs43. Show Description
qyIs43 [pat-3::GFP + ina-1(genomic) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Hagedorn et al., Dev Cell (2009) Aug 17(2):187-98.
|
|
| NK364 |
C. elegans |
unc-119(ed3) III; qyIs46. Show Description
qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
|
|
