| CB4567 |
C. elegans |
unc-53(e2432) II. Show Description
Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration.
|
|
| CB5101 |
C. elegans |
dpy-26(n199) IV; eEx36. Show Description
eEx36 [F16E1 + rol-6(su1006)]. eEx36 carries multiple copies of fox-1, which confers a Xol phenotype and pRF4 which confers a Rol phenotype. dpy-26(n199) is XO viable and XX lethal. Strain consists mostly of Rol hermaphrodites and non-Rol males, all XO.
|
|
| CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
| DA2250 |
C. elegans |
mgl-2(tm355) I; mgl-1(tm1811) X. Show Description
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
|
|
| EL129 |
C. elegans |
ego-3(om40) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.
|
|
| EL694 |
C. elegans |
pup-4(om140) II. Show Description
pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om140 is a CRISPR-engineered internal deletion removing most of the pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
|
|
| EL713 |
C. elegans |
pup-4(om141) II. Show Description
pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om141 is a CRISPR-engineered deletion removing the entire pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
|
|
| ET65 |
C. elegans |
cul-2(ek1)/unc-64(e246) III. Show Description
Heterozygotes are WT and segregate WT, Unc and adult steriles (cul-2 homozygotes). cul-2 homozygotes have large germ cells and lay few eggs (slightly temperature sensitive, with more eggs at lower temperatures) that arrest early in development with multiple nuclei.
|
|
| FT778 |
C. elegans |
unc-119(ed3) III; xnIs299. Show Description
xnIs299 [hmr-1p::hmr-1::mCherry + unc-119(+)]. Translational fusion to hmr-1. HMR-1::mCherry is visible in multiple tissues including pharynx, intestine, epidermis and gonad; also marks the adherens junctions in epithelia. No visible maternal expression. Reference: Zilberman Y, et al. 2017: J Cell Biol. (In press).
|
|
| GA800 |
C. elegans |
wuIs151. Show Description
wuIs151 [ctl-1(+) + ctl-2(+) + ctl-3(+) + myo-2p::GFP]. wuIs151 contains multiple copies of a PCR fragment containing the entire ctl-1 ctl-2 ctl-3 gene cluster. Slow growing, especially at 25 degrees. Raise at 20 degress or cooler.
|
|
| KK696 |
C. elegans |
ooc-5(it145) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Uncs. it145 is a recessive mutation that results in multiple rows of small oocytes instead of a single row of normal size oocytes. it145 is a recessive maternal effect lethal mutation: hermaphrodites produce embryos that fail to hatch - the embryos exhibit a partial defect in P0 nuclear rotation and a strong defect in P1 nuclear rotation; PAR proteins are mislocalized in P1.
|
|
| KR3784 |
C. elegans |
unc-46(e177) mdf-1(gk2) such-2(h1992) V. Show Description
Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain.
|
|
| KR3870 |
C. elegans |
emb-30(h1959) III; unc-46(e177) mdf-1(gk2) V. Show Description
Temperature sensitive allele. Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain. Maintain at 20C; 100% Emb at 25C.
|
|
| KR4010 |
C. elegans |
emb-30(h1962) III; unc-46(e177) mdf-1(gk2) V. Show Description
Temperature sensitive allele. Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain. Maintain at 20C; sterile at 25C.
|
|
| KR4012 |
C. elegans |
such-1(h1960) III; unc-46(e177) mdf-1(gk2) V. Show Description
Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain.
|
|
| KR4063 |
C. elegans |
such-3(h1989) II; unc-46(e177) mdf-1(gk2) V. Show Description
Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain.
|
|
| KR4064 |
C. elegans |
such-5(h1987) II; unc-46(e177) mdf-1(gk2) V. Show Description
Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain.
|
|
| KR4311 |
C. elegans |
fzy-1(h1988) II; unc-46(e177) mdf-1(gk2) V. Show Description
Temperature sensitive allele. Unc-46. Slow growing. Lva. Emb. Him. Pick multiple worms to maintain as it is difficult to grow this strain. Maintain at 20C; sterile at 25C.
|
|
| LP176 |
C. elegans |
unc-119(ed3) III; che-12(cp25[che-12::GFP + LoxP + unc-119(+) + LoxP]) V. Show Description
N-terminally tagged GFP::CHE-12. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.
|
|
| LP198 |
C. elegans |
unc-119(ed3) III; che-12(cp34[gfp::che-12 + LoxP + unc-119(+) + LoxP]) V. Show Description
C-terminally tagged CHE-12::GFP. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.
|
|
| LP869 |
C. elegans |
cpSi171 I. Show Description
cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.
|
|
| MAD36 |
C. elegans |
unc-119(ed3) III; dqIs44. Show Description
dqIs44 [pie-1::mCherry::moe + unc-119(+)]. Can be maintained at room temperature; shift to 25C for RNAi and imaging. Strain does not do well when kept at 25C for multiple generations. Reference: Shivas JM & Skop AR. Mol Biol Cell. 2012 May;23(10):1917-27.
|
|
| MLY80 |
C. elegans |
Probably has multiple mutations. Show Description
Slow generation time, 6-7 days. Progeny production and survival to reproduction are reduced.
|
|
| MT152 |
C. elegans |
unc-53(n152) II. Show Description
Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration. See also WBPaper00005353.
|
|
| MT8704 |
C. elegans |
ces-1(n703n1434) I. Show Description
n1434 restores death of NSM and I2 sister. n703sd: multiple (3-4) NSMs.
|
|
| N2 (ancestral) |
C. elegans |
C. elegans wild type (anCestral). Show Description
WT C. elegans. From Cambridge collection-originally frozen around 1968: In 1980, in order to establish an ancestral stock, Jonathan Hodgkin thawed one of the earliest frozen tubes of N2, dating from 1968. From this plate J.H. grew up a population en masse (without subculturing) on NGM plates (about 2 generations). Multiple samples of this were frozen in order to provide a reference N2 stock. This set of stock samples was replenished by regrowth in 1985 and 1991, using the same procedure, and a freshly thawed sample was sent to the CGC in 1993. Thus, samples from this frozen stock, called N2 (ancestral), should be only about 6 generations away from the stock used by Sydney Brenner as his standard WT N2. [Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966.] Caenorhabditis elegans wild isolate. Note: N2 (ancestral) has reduced lifespan and fertility relative to the standard CGC N2 strains. See Worm Breeder's Gazette 16(5): 24 (February 1,2001).
|
|
| NC996 |
C. elegans |
wdEx451. Show Description
wdEx451 [Y71D11A.5::GFP + rol-6(su1006))]. Pick rollers to maintain. GFP expression in VD, DD, and AS neurons, multiple head and tail neurons, and muscles.
|
|
| NJ683 |
C. elegans |
exc-7(rh252) II. Show Description
Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.
|
|
| NL1242 |
C. elegans |
acy-2(pk465) V; pkEx467. Show Description
pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.
|
|
| NL2550 |
C. elegans |
ppw-1(pk2505) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. Multiple polymorphisms in C18E3.7 including a single base deletion in ppw-1 resulting in an early stop codon.
|
|
| PJ1069 |
C. elegans |
let-60(sy93) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dominant Vul allele, however, worms appear to be Egl and have multiple pseudovulvae (due to sup-7??).
|
|
| PS2746 |
C. elegans |
dpy-20(e1282) IV; syEx234. Show Description
syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC.
|
|
| TV17465 |
C. elegans |
dma-1(wy908) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV26120 |
C. elegans |
rab-11.1(wy1444) gip-2(lt19[gip-2::GFP]) I; wyEx10192. Show Description
wyEx10192 [unc-86p::Cre + lin-32p::mCherry + odr-1p::GFP]. Pick animals with odr-1::GFP expression to maintain array. GFP tag inserted into endogenous gip-2 locus. Low penetrance, multiple gip-2 cluster in soma or dendrite rab-11.1. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.
|
|
| VC100 |
C. elegans |
unc-112(r367) V; gkDf2 X. Show Description
gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1270 |
C. elegans |
lin-31(gk569) II. Show Description
K10G6.1. Variable vulval phenotypes. Mostly wild type and able to lay eggs, but some animals have defective vulvae and become bags of worms. Some animals have multiple pseudovulvae. External left primer: TAGACACCCCACCATTCCAT. External right primer: TCGGCTGAACCAAATACACA. Internal left primer: CAGTTCTCGGGTGGTCTGAT. Internal right primer: AGCCTAATCCTAAGCCGGAG. Internal WT amplicon: 2297 bp. Deletion size: 1922 bp. Deletion left flank: TAGTGATGTGAATGTAAAACAAAGACTTAT. Deletion right flank: GCTTAAATTTAGGTTTAGGCTTAGGCTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC500 |
C. elegans |
kdin-1(ok750) IV/nT1 [qIs51] (IV;V). Show Description
F36H1.2. Homozygous viable deletion balanced with GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok750 homozygotes (viable with small broods and multiple morphological defects, often sterile, sometimes explode at vulva). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC545 |
C. elegans |
elo-3(gk236) IV. Show Description
D2024.3. Gro. Deletion may involve chromosome rearrangement, as multiple constructs of gk236/nT1[qIs51] were unstable. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| ZM10538 |
C. elegans |
hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVBs calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
|
|
| ZM10942 |
C. elegans |
lin-15B&lin-15A(n765) X; hpIs774; hpEx4292. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA.
|
|