More Fields
Strain Species Genotype
AA1 C. elegans daf-12(rh257) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions.
AA10 C. elegans daf-12(rh286) X. Show Description
Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele.
AA107 C. elegans nhr-48(ok178) X. Show Description
ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp.
AA120 C. elegans dhIs26. Show Description
dhIs26 [daf-12a::GFP + lin-15(+)]. DAF-12::GFP localized primarily in nucleus, except during mitosis. Expressed widely in most cells including tissues modified for dauer formation or by stage from embryo to adult, but most elevated and widespread during L2.
AA18 C. elegans daf-12(rh61rh412) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele.
AA277 C. elegans lin-15B&lin-15A(n765) X; dhIs64. Show Description
dhIs64 [daf-9p::daf-9::GFP + lin-15(+)].
AA278 C. elegans dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
AA292 C. elegans daf-36(k114) V. Show Description
Mig on low cholesterol. Single daf-c at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C.
AA34 C. elegans daf-12(rh61) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.
AA408 C. elegans din-1(dh127) II. Show Description
daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects.
AA411 C. elegans din-1(dh149) II. Show Description
daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects.
AA426 C. elegans dre-1(dh99) V. Show Description
Precocious fusion of seam cells one stage earlier (prior to L3 molt); impenetrant gonadal migration defects; SynMig on daf-12 RNAi.
AA6 C. elegans daf-12(rh84) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.
AA699 C. elegans din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
AA776 C. elegans cyp-44A1(ok216) II. Show Description
AA790 C. elegans lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
AA82 C. elegans daf-12(rh284) X. Show Description
Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele.
AA83 C. elegans daf-12(rh62rh157) X. Show Description
daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele.
AA85 C. elegans daf-12(rh285) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele.
AA86 C. elegans daf-12(rh61rh411) X. Show Description
Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
AA87 C. elegans daf-12(rh273) X. Show Description
Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele.
AA88 C. elegans daf-12(rh193) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele.
AA89 C. elegans daf-12(rh274) X. Show Description
daf-c. Gonadal Mig. Weak heterochronic phenotypes in intestine. Class VI allele.
AA968 C.elegans nhr-8(hd117) IV. Show Description
Mig on low cholesterol. Reference: Magner DB, et al. Cell Metab. 2013 Aug 6;18(2):212-24. doi: 10.1016/j.cmet.2013.07.007.PMID: 23931753
AB1 C. elegans Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VII).
AB2 C. elegans Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII).
AB3 C. elegans Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII).
AB4 C. elegans Show Description
Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII).
ABR1 C. elegans pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
ABR14 C. elegans shEx34. Show Description
shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR16 C. elegans shEx1. Show Description
shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
ABR339 C. elegans lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
ABR4 C. elegans pha-1(e2123) III; staEx4. Show Description
staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
ABR5 C. elegans unc-119(ed3) III; staIs1. Show Description
staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
ABR7 C. elegans unc-119(ed3) III; staIs2. Show Description
staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195.
ABR9 C. elegans set-2(ok952) III; rbr-2(tm1231) IV. Show Description
Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
AC196 C. elegans sao-1(ik1) V. Show Description
Superficially wild-type. Suppresses of aph-1(zu147). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AC257 C. elegans ppk-3(n2668) X. Show Description
Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality.
AC365 C. elegans sao-1(ok3335) V. Show Description
Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AC68 C. elegans unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs.
AD186 C. elegans egg-1(tm1071) III. Show Description
Temperature sensitive sterile. Maintain at 20C. Fertility is <10% of WT at 25C.
AD189 C. elegans unc-119(ed3) III; asIs2. Show Description
asIs2 [pie-1p::GFP::egg-1 + unc-119(+)]. Oocyte membranes are GFP+.
AD200 C. elegans unc-119(ed3) III; asIs1. Show Description
asIs1 [pie-1p::GFP::egg-3 + unc-119(+)].
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AD226 C. elegans egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
AD238 C. elegans asIs2. Show Description
asIs2 [pie-1p::mCherry::egg-3].