Search Strains

Moves relatively well. Recessive.

Maternally rescued variable abnormal. Some embryonic lethality and a very high level of larval lethality. Head frequently deformed because the buccal cavity does not open at the tip of the head but ventrally, dorsally or laterally.

Heterozygotes are WT and segregate WT, DpyUncs, and arrested larvae (hlh-14 homozygotes).

uthIs205 [crtc-1p::crtc-1::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged CRTC-1 expression from native promoter. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

Animals heterozygous for mnDp33 are WT and segregate WT and lethals. Animals which have lost mnDp33 arrest as two fold L1 larvae. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).

Heterozygotes are WT and segregate WT, paralyzed Dpys and lethals.

Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.

zdIs5 [mec-4p::GFP + lin-15(+)] I.

jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15C and exhibit a withered tail tip phenotype at 20C and 25C. pcyt-1(et9) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); pcyt-1(et9) double mutants can be propagated at 15C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et10) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et10) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et11) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et11) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. hacd-1(et12) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); hacd-1(et12) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et13) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et13); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. mdt-15(et14) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. mdt-15(et14); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.

Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25°C. Unable to grow at 15°C. Withered tail-tip phenotype at 20°C and 25°C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.

No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.

This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056

rpa-4(iow21) deletion generated by CRISPR in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.

Homozygous viable. Increased embryonic lethality after irradiation.

vkIs3785 [nhx-2p::gfp::lgg-1::mKate2]; inserted into LG X. Fluorescent reporter for autophagic flux. GFP aggregation in intestine. Reference: Dawson ZD, et al. Autophagy rep. 2024;3(1):2371736. doi: 10.1080/27694127.2024.2371736. PMID: 39070663.