Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CE778 C. elegans unc-29(e1072) aph-1(ep140)/fog-3(q443) I. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
EU1516 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).
EU1513 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1515 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. Show Description
Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1514 C. elegans aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.
AC196 C. elegans sao-1(ik1) V. Show Description
Superficially wild-type. Suppresses of aph-1(zu147). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AC456 C. elegans aph-1(tm4743)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4743 homozygotes (Egl, Mel, adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-1(tm4743) deletion allele was generated by the National BioResource Project of Japan, part of the International C. elegans Gene Knockout Consortium. Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968.
BOX188 C. elegans maph-1.1(mib12[GFP::maph-1.1]) I. Show Description
Endogenous maph-1.1 locus tagged with GFP using CRISPR/Cas9. Animals are homozygous viable and express GFP::maph-1.1 ubiquitously. Reference: Waaijers S, et al. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. PMID: 27506200
RG3527 C. elegans maph-1.2(ve1027[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAATAAATTTACTCGGGGGGAAAAATAA ; Right flanking sequence: TGGAAGCTAGTATTTCTGGTTATTTTTAGA. maph-1.2 crRNA A: TAAATAAGTTATGCgggggg; maph-1.2 crRNA B: AATCAATACGCCACTTCTAT. [NOTE: maph-1.2 shares sequence identity with other loci on LGIII and LGIV. Classical genetic mapping was performed confirm the location of the INDEL in LGI.] Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
STR318 C. elegans unc-119(ed3) III; hrtSi28 IV. Show Description
hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
VC4473 C. elegans maph-1.3(gk5546[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4864 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGTTGAAAATGAAAAAAATCCACCCATC. Right flanking sequence: ATGGGGTGTGCCCGACAAAAATGGGGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4576 C. elegans maph-1.1(gk5647[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.