Search Strains

More Fields
Strain Species Genotype Add
RB1277 C. elegans gcy-6(ok1293) V/nT1 [qIs51] (IV;V). Show Description
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1278 C. elegans let-502(ok1283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1279 C. elegans rfs-1(ok1372) III. Show Description
C30A5.2 Homozygous. Outer Left Sequence: cttccaaatcagcagcaaca. Outer Right Sequence: tctggttgtcgaatgagcag. Inner Left Sequence: ttgcacaaatcgctaatcca. Inner Right Sequence: tgggagtcttgtagtgggct. Inner Primer PCR Length: 2227. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1280 C. elegans F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1282 C. elegans C25E10.11(ok1380) V. Show Description
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1284 C. elegans C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1285 C. elegans lys-7(ok1384) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1286 C. elegans lys-7(ok1385) V. Show Description
C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1287 C. elegans VZC374L.1(ok1386) X. Show Description
VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1288 C. elegans C48C5.1(ok1387) X. Show Description
C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1289 C. elegans C43C3.2(ok1388) X. Show Description
C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1290 C. elegans npp-14(ok1389) I. Show Description
C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1291 C. elegans C05D10.1(ok1390) Show Description
C05D10.1 Homozygous. Outer Left Sequence: gcctccctcattcattttca. Outer Right Sequence: atcgggtggtctgttttgag. Inner Left Sequence: aataaaatttgccgctgtgg. Inner Right Sequence: gtcccgagttgttgtcgttt. Inner Primer PCR Length: 3047. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1292 C. elegans aex-3(ok1391). Show Description
C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1293 C. elegans C35E7.1(ok1392) I. Show Description
C35E7.1 Homozygous. Outer Left Sequence: gctcaagaaagccaatggag. Outer Right Sequence: catggagtttgctcgtctga. Inner Left Sequence: atgagcaagttgccgagagt. Inner Right Sequence: gtgggagtactgtaggggca. Inner Primer PCR Length: 2849. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1294 C. elegans C49G7.8(ok1393) V. Show Description
C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1295 C. elegans F10C1.5(ok1394) II. Show Description
F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1296 C. elegans C17H12.9(ok1395) IV. Show Description
C17H12.9 Homozygous. Outer Left Sequence: agttcctctgccgcttgtaa. Outer Right Sequence: aagttcggggaatttcgtct. Inner Left Sequence: gcaaccacgtagcttcacaa. Inner Right Sequence: ttggaaatggaatcacccat. Inner Primer PCR Length: 3028. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1297 C. elegans rhy-1(ok1402) II. Show Description
W07A12.7 Homozygous. Outer Left Sequence: cgtcagcatacccagtgttg. Outer Right Sequence: tcaatggcattagcaactcg. Inner Left Sequence: ctccccgttacattttgcat. Inner Right Sequence: tgggtggcaaaagaaaacat. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1298 C. elegans C25E10.11(ok1405) V. Show Description
C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1299 C. elegans C24H12.9(ok1406) II. Show Description
C24H12.9 Homozygous. Outer Left Sequence: tcaattccttgtttttgggc. Outer Right Sequence: gtcttgctcgcctctttctg. Inner Left Sequence: gtgcctccaaattacgcact. Inner Right Sequence: atcatccgagatccatttgc. Inner Primer PCR Length: 2113. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1300 C. elegans cdc-14(ok1407) II. Show Description
C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1301 C. elegans unc-23(ok1408) V. Show Description
H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1302 C. elegans Y2C2A.1(ok1409) IV. Show Description
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1303 C. elegans D2096.12(ok1410) IV. Show Description
D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1304 C. elegans wdr-5.1(ok1417) III. Show Description
C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1305 C. elegans egl-1(ok1418) V. Show Description
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1306 C. elegans str-182(ok1419) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1307 C. elegans F52D1.1(ok1423) X. Show Description
F52D1.1 Homozygous. Outer Left Sequence: tagcggtatgggcgatttac. Outer Right Sequence: ccggcaagtagattgagagc. Inner Left Sequence: cactgcgaccaaagtcttga. Inner Right Sequence: caatatcacgcaggttgtgg. Inner Primer PCR Length: 2819. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1308 C. elegans rnp-3(ok1424) IV. Show Description
K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1309 C. elegans C02C2.1(ok1425) III. Show Description
C02C2.1 Homozygous. Outer Left Sequence: cggcacactggcagttatta. Outer Right Sequence: cgtgcttgttccagatctca. Inner Left Sequence: cagacatggtccaaacatgc. Inner Right Sequence: gggaaggaaaacgacacgta. Inner Primer PCR Length: 2920. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1310 C. elegans clc-2(ok1426) X. Show Description
C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1311 C. elegans R05D11.8(ok1427) I. Show Description
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1312 C. elegans C54E4.2(ok1428) IV. Show Description
C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1313 C. elegans C05C10.2(ok1429) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1314 C. elegans C05C10.2(ok1430) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1315 C. elegans C49G7.1(ok1431) V. Show Description
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1316 C. elegans unc-105(ok1432) II. Show Description
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1317 C. elegans srp-3(ok1433) V. Show Description
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1318 C. elegans Y66D12A.5(ok1436) III. Show Description
Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1319 C. elegans C34D4.14(ok1437) IV. Show Description
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1320 C. elegans Y67D8A.3(ok1438) IV. Show Description
Y67D8A.3 Homozygous. Outer Left Sequence: aatttgtgcaaacaccgtca. Outer Right Sequence: gacaacctttgcgctttttc. Inner Left Sequence: ttttgtcaacaaattcggca. Inner Right Sequence: gccactctacttttcgccac. Inner Primer PCR Length: 2198. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1321 C. elegans C56G3.1(ok1439) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1322 C. elegans F33H2.6(ok1440) I. Show Description
F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1323 C. elegans C06G1.5(ok1441) X. Show Description
C06G1.5 Homozygous. Outer Left Sequence: gcatagcaccgtgaatgaga. Outer Right Sequence: gcgtaggatggattgaagga. Inner Left Sequence: ttcgtgaacatttggggaat. Inner Right Sequence: ctggcagtgcgaatcaacta. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1324 C. elegans ssr-2(ok1375) X. Show Description
C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1325 C. elegans C53C7.1(ok1442) X. Show Description
C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1326 C. elegans unc-129(ok1443) IV. Show Description
C53D6.2 Homozygous. Outer Left Sequence: agtcgtttctaccgcttcca. Outer Right Sequence: acctttgccggttcctctat. Inner Left Sequence: aacaaaacatcgggacgaag. Inner Right Sequence: tggtcaccgatatgggaact. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1327 C. elegans K04G11.4(ok1444) X. Show Description
K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1328 C. elegans dsh-1(ok1445) II. Show Description
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807