More Fields
Strain Species Genotype
RB1321 C. elegans C56G3.1(ok1439) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807