Search Strains

rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.

hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.

Superficially wild-type. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.

rhIs13 [unc-119::GFP + dpy-20(+)]. RNAi hypersensitive, effective RNAi in the nervous system. unc-119::GFP in neurons is almost completely suppressed on anti-GFP RNAi plates. Reduced progeny at 25C (almost sterile). nre-1(hd20) and lin-15B(hd126) seem very closely linked. Maintain at 15C or 20C.

Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 11634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCTGGGGCACCGCCTACTTTTGCCGCCG; Right flanking sequence: CGAAAGAAATCGAGTATTTTCAAATCATTT. sgRNA #1: ATTGCTGACGGTGGGCGCGG; sgRNA #2: CATCCGAACTAAATTATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1144 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTACAGTTCACAATCGCGTCACACCC; Right flanking sequence: GGGGACAAGCTGAGCTATGCAGATTATGCT. sgRNA #1: CGAAAATATAATCGGGTTAG; sgRNA #2: ACGGCGAAAACTTTGTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATCAAATTCATTTTTGGATCAATCGGTT; Right flanking sequence: TGGGTTATTCATAAGGTGTGAGTCCCAAAA. sgRNA #1: GTTTTAGGAGCACATCACGG; sgRNA #2: ATCATCACGGCAGACACAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCTACATTCAGGGGTGTTTTTTCATATCT; Right flanking sequence: CGGCAATTGTCGCAAAAAATTTGGTGTGAC. sgRNA #1: CAAAGCTATGATGTGGTCCA; sgRNA #2: GCCAGCGTCTGTTAGAGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

wwEx34 contains [hlh-31::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

wwEx41 [hlh-13::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.

wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx43 [hlh-27::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx23 [mir-270p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx20 [mir-245p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx26 [mir-42-44p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx44 [hlh-33::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx35 [hlh-16::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs3 [mir-236::GFP + unc-119(+)]. Wild-type.

wwEx28 [mir-72p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx52 [nhr-86p::GFP + unc-119(+)]. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx45 [unc-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs4 [mir-238p::GFP + unc-119(+)]. Wild type.

wwEx46 [lin-22::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx30 [mir-57p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx47 [hlh-30::GFP + unc-119(+)]. Pick wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs5 [mir-240-786p::GFP + unc-119(+)]. Wild type.

wwEx29 [mir-83p::GFP + unc-119(+)]. Maintain by picking WT.

wwEx31 [mir-268p::GFP + unc-119(+)]. Maintain by picking WT.

wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs15 [mir-63p::GFP + unc-119(+)]. Wild-type.

wwIs18 [mir-79p::GFP + unc-119(+)]. Wild type.

wwIs8 [mir-35-41p::GFP + unc-119(+)]. Wild-type.

wwEx24 [mir-355p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwEx25 [mir-359p::GFP + unc-119(+)]. Maintain by picking non-Unc.

wwIs1[mdl-1::GFP + unc-119(+)]. Worms are non-Unc.

wwEx32 [mir-61-250p::GFP + unc-119(+)]. Maintain by picking WT.