Search Strains

More Fields
Strain Species Genotype Add
RB1300 C. elegans cdc-14(ok1407) II. Show Description
C17G10.4 Homozygous. Outer Left Sequence: cagtcgtggatgaacactcg. Outer Right Sequence: caccacaaatgactgttccg. Inner Left Sequence: gagacacttttctcggacgg. Inner Right Sequence: tgaatcgaaatcgtgaacca. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1301 C. elegans unc-23(ok1408) V. Show Description
H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1302 C. elegans Y2C2A.1(ok1409) IV. Show Description
Y2C2A.1 Homozygous. Outer Left Sequence: tcccatcattctccgaaaag. Outer Right Sequence: gaagaggtggtcgatcagga. Inner Left Sequence: ttgaatgcgtatcggatgaa. Inner Right Sequence: agctcgaggggttttctctc. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1303 C. elegans D2096.12(ok1410) IV. Show Description
D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1305 C. elegans egl-1(ok1418) V. Show Description
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1306 C. elegans str-182(ok1419) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1307 C. elegans F52D1.1(ok1423) X. Show Description
F52D1.1 Homozygous. Outer Left Sequence: tagcggtatgggcgatttac. Outer Right Sequence: ccggcaagtagattgagagc. Inner Left Sequence: cactgcgaccaaagtcttga. Inner Right Sequence: caatatcacgcaggttgtgg. Inner Primer PCR Length: 2819. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1308 C. elegans rnp-3(ok1424) IV. Show Description
K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1309 C. elegans C02C2.1(ok1425) III. Show Description
C02C2.1 Homozygous. Outer Left Sequence: cggcacactggcagttatta. Outer Right Sequence: cgtgcttgttccagatctca. Inner Left Sequence: cagacatggtccaaacatgc. Inner Right Sequence: gggaaggaaaacgacacgta. Inner Primer PCR Length: 2920. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1310 C. elegans clc-2(ok1426) X. Show Description
C01C10.1 Homozygous. Outer Left Sequence: ctccggttgcatcagaaaat. Outer Right Sequence: cctgccaagctggtgttatt. Inner Left Sequence: tgttcaaatttttgctgcca. Inner Right Sequence: tttgtttgtcagcagtccgt. Inner Primer PCR Length: 2117. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1311 C. elegans R05D11.8(ok1427) I. Show Description
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1312 C. elegans C54E4.2(ok1428) IV. Show Description
C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1313 C. elegans C05C10.2(ok1429) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1314 C. elegans C05C10.2(ok1430) II. Show Description
C05C10.2 Homozygous. Outer Left Sequence: gatgtcatgcgagagatgga. Outer Right Sequence: tggtggcagttgatgaatgt. Inner Left Sequence: gccaaattcgcaacaagaat. Inner Right Sequence: ccaaagcttgcattgttgaa. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1315 C. elegans C49G7.1(ok1431) V. Show Description
C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1316 C. elegans unc-105(ok1432) II. Show Description
C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1317 C. elegans srp-3(ok1433) V. Show Description
Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1318 C. elegans Y66D12A.5(ok1436) III. Show Description
Y66D12A.5 Homozygous. Outer Left Sequence: caagcttctcacaccgatca. Outer Right Sequence: gctacgcttcaagaaatccg. Inner Left Sequence: attgctcgaaaagctggaaa. Inner Right Sequence: cggacctcttcatcgtcatt. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1319 C. elegans C34D4.14(ok1437) IV. Show Description
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1320 C. elegans Y67D8A.3(ok1438) IV. Show Description
Y67D8A.3 Homozygous. Outer Left Sequence: aatttgtgcaaacaccgtca. Outer Right Sequence: gacaacctttgcgctttttc. Inner Left Sequence: ttttgtcaacaaattcggca. Inner Right Sequence: gccactctacttttcgccac. Inner Primer PCR Length: 2198. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1321 C. elegans C56G3.1(ok1439) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1322 C. elegans F33H2.6(ok1440) I. Show Description
F33H2.6 Homozygous. Outer Left Sequence: acggtgctagattcggaaaa. Outer Right Sequence: tgttcgaaaaaggttttggc. Inner Left Sequence: agatccggaatttcaccaga. Inner Right Sequence: cgggatttttcaccatctgt. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1323 C. elegans C06G1.5(ok1441) X. Show Description
C06G1.5 Homozygous. Outer Left Sequence: gcatagcaccgtgaatgaga. Outer Right Sequence: gcgtaggatggattgaagga. Inner Left Sequence: ttcgtgaacatttggggaat. Inner Right Sequence: ctggcagtgcgaatcaacta. Inner Primer PCR Length: 3306. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1324 C. elegans ssr-2(ok1375) X. Show Description
C14A11.7 Homozygous. Outer Left Sequence: ttctttcacccccttttcct. Outer Right Sequence: cgccttatttcagcttttgc. Inner Left Sequence: ttttgcaatcactctcgtcg. Inner Right Sequence: gcaaggaaggcattttggta. Inner Primer PCR Length: 2887. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1325 C. elegans C53C7.1(ok1442) X. Show Description
C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1326 C. elegans unc-129(ok1443) IV. Show Description
C53D6.2 Homozygous. Outer Left Sequence: agtcgtttctaccgcttcca. Outer Right Sequence: acctttgccggttcctctat. Inner Left Sequence: aacaaaacatcgggacgaag. Inner Right Sequence: tggtcaccgatatgggaact. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1327 C. elegans K04G11.4(ok1444) X. Show Description
K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1328 C. elegans dsh-1(ok1445) II. Show Description
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1329 C. elegans C56G3.1(ok1446) X. Show Description
C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1330 C. elegans npr-1(ok1447) X. Show Description
C39E6.6 Homozygous. Outer Left Sequence: tcagcaaaattcccgatttc. Outer Right Sequence: gaacctgttagtgggccaag. Inner Left Sequence: gatcaattcttccggctcag. Inner Right Sequence: ggccaaatggaagttgaaaa. Inner Primer PCR Length: 2687. 11/24/04: From Neline Kriek: ok1447 is a 1263 bp deletion with a 1 bp insertion (T). The sequence is: gtatcagcattttcgtatgcacTacgttttgagaagtttcatt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1331 C. elegans end-3(ok1448) V. Show Description
F58E10.5 Homozygous. Outer Left Sequence: cgggaatagcggtaatttga. Outer Right Sequence: gtgatgtgcgtggctgtaac. Inner Left Sequence: cactctcgcacgtgaaaaac. Inner Right Sequence: caatgcctgtcttttgagca. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1332 C. elegans trx-1(ok1449) II. Show Description
B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1333 C. elegans hrpr-1(ok1278) I/ ? hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) ?. Show Description
F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1334 C. elegans C34D4.14(ok1450) IV. Show Description
C34D4.14 Homozygous. Outer Left Sequence: ttttgcctcccttcttctga. Outer Right Sequence: atttcttcatcggcaccaac. Inner Left Sequence: attggtggtagcgtctttgg. Inner Right Sequence: ggatggagttcacacggagt. Inner Primer PCR Length: 3257. Estimated Deletion Size: about 1550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1335 C. elegans T21C9.1(ok1451) V. Show Description
T21C9.1 Homozygous. Outer Left Sequence: aatattcccaccactcgcac. Outer Right Sequence: ccacggaatgtcttgaaggt. Inner Left Sequence: ccgagaagctgggagttcta. Inner Right Sequence: gaaaaagaaggttccggctc. Inner Primer PCR Length: 2126. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1336 C. elegans C53A5.4(ok1452) V. Show Description
C53A5.4 Homozygous. Outer Left Sequence: cttgcactcattctcaccca. Outer Right Sequence: gacaggctcgaggtgaagtc. Inner Left Sequence: tccgtttttggttccagttc. Inner Right Sequence: ctttgaacacacgtagccga. Inner Primer PCR Length: 2366. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1337 C. elegans hlh-26(ok1453) II. Show Description
C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1338 C. elegans C13G3.3(ok1467) V. Show Description
C13G3.3 Homozygous. Outer Left Sequence: gatgtgcaaagagtggggtt. Outer Right Sequence: ttggtttgttacgcctttcc. Inner Left Sequence: aaagtcgcatttggatttgc. Inner Right Sequence: tttccccaacttcacgaaac. Inner Primer PCR Length: 2336. Estimated Deletion Size: about 550 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1339 C. elegans C01G5.6(ok1468) IV. Show Description
C01G5.6 Homozygous. Outer Left Sequence: caaacattttgcgtcggaat. Outer Right Sequence: tcggaatttcttgtccgttc. Inner Left Sequence: tccttgtcatcgttttgcac. Inner Right Sequence: tcagcttgaacattgctgct. Inner Primer PCR Length: 2131. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1340 C. elegans nlp-1(ok1469) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1341 C. elegans nlp-1(ok1470) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1342 C. elegans ogt-1(ok1474) III. Show Description
K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1343 C. elegans T06A10.4(ok1475) IV. Show Description
T06A10.4 Homozygous. Outer Left Sequence: ttctatgggcggagtttagc. Outer Right Sequence: aaaatgcaatttttccgtgc. Inner Left Sequence: gcgggaaatctttggttttt. Inner Right Sequence: ccgaattgtaagggcatgtt. Inner Primer PCR Length: 2193. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1344 C. elegans zig-3(ok1476) X. Show Description
C14F5.2 Homozygous. Outer Left Sequence: tggttacccatctgcgtgta. Outer Right Sequence: gcatgttccttcatttccgt. Inner Left Sequence: ttcgcgcacattttgagtag. Inner Right Sequence: gacaagatcattggcgaggt. Inner Primer PCR Length: 2296. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1345 C. elegans coq-4(ok1490) I. Show Description
T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1346 C. elegans EEED8.16(ok1492) II. Show Description
vEEED8.16 Homozygous. Outer Left Sequence: acgcgaaagaaagcgaataa. Outer Right Sequence: cttgacacacctgccacatc. Inner Left Sequence: caattttctcgacgaggagg. Inner Right Sequence: tttcatgccagtctattgcg. Inner Primer PCR Length: 2911. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1347 C. elegans set-2(ok1493) III. Show Description
C26E6.11 Homozygous. Outer Left Sequence: tggatgggtcaaatggtagc. Outer Right Sequence: attgtctgtgtggtgcgaag. Inner Left Sequence: tggcgagtttcacaagaatg. Inner Right Sequence: aattcgctggttcgaagttg. Inner Primer PCR Length: 2404 Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1348 C. elegans M195.2(ok1503) II. Show Description
M195.2 Homozygous. Outer Left Sequence: acgaggtatctgccaacgac. Outer Right Sequence: ctccaagagccttatcaccg. Inner Left Sequence: tagactgatgcgaaatcccc. Inner Right Sequence: gtttctggcttcaatttcgg. Inner Primer PCR Length: 2246. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1349 C. elegans F57H12.4(ok1504) IV. Show Description
F57H12.4 Homozygous. Outer Left Sequence: atttgccccctttgagactt. Outer Right Sequence: tgctttttccgaaattccat. Inner Left Sequence: tgccccctaagaacattgac. Inner Right Sequence: taacatgctgctggcatttc. Inner Primer PCR Length: 2957. Estimated Deletion Size: about 1300 bp. The breakpoint sequence from Neline Kriek is: atccatcaatgcatca - breakpoint - agcgcaatattcaag. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1350 C. elegans trpl-5(ok1507) II. Show Description
T16A1.7 Homozygous. Outer Left Sequence: cccattttgtgaattctggg. Outer Right Sequence: ccggtttgccaattttctta. Inner Left Sequence: tcattttggccattttgtga. Inner Right Sequence: aaatgttcaattccggcaac. Inner Primer PCR Length: 3057. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807