Search Strains

F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 2058 bp. Deletion left flank: TGAAAATAGTACTGTAGGATTACTGGAACT. Deletion right flank: AGGCCAAGTATCCAAAGACACTCATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.4 Homozygous. Outer Left Sequence: gaaatctagcacctacggcg. Outer Right Sequence: aatgtgtcgtgtggagacca. Inner Left Sequence: gtacggtgtctatcgcggac. Inner Right Sequence: atcaaaatgcggagaaatgg. Inner Primer PCR Length: 2165. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 1719 bp. Deletion left flank: ATGGACAATTGGATGCATTTTCTGTAGTTG. Deletion right flank: GACTTGCTCATACCTTATTTGAATTGTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04E12.7 Homozygous. Outer Left Sequence: atttcaccttcagcaccgtc. Outer Right Sequence: acggcagaaaacaatgttcc. Inner Left Sequence: tgcttttcacaaatcaacgg. Inner Right Sequence: ctgcgctttttccttcattc. Inner Primer PCR Length: 2174. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38C10.4 Homozygous. Outer Left Sequence: ggaagagcattttcccatca. Outer Right Sequence: atatcagaaagcggcgctaa. Inner Left Sequence: gctggcagtctccatctctc. Inner Right Sequence: gatccgcgtgaaatttttgt. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18C4.2 Homozygous. Outer Left Sequence: gtgggtctcgaagggaattt. Outer Right Sequence: tgagattttcccgatccaac. Inner Left Sequence: aggtgagggaaaccacactg. Inner Right Sequence: tttcaatttttccgtcgtcc. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01B6.1 Homozygous. Outer Left Sequence: tccgtgaggcttagcagaat. Outer Right Sequence: ggaacaggaattgtgaggga. Inner Left Sequence: ccaaaacccgaaacttctca. Inner Right Sequence: tcaaatcgagttcttcgcct. Inner Primer PCR Length: 3303. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43B11AR.3 Homozygous. Outer Left Sequence: ctgtgactggtgcagttgct. Outer Right Sequence: actggaggacgtaacgttgg. Inner Left Sequence: cgatgtgagttctgctggaa. Inner Right Sequence: aaagtccggctaaggttggt. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.14 Homozygous. Outer Left Sequence: taatatgagcaatgcgcgtc. Outer Right Sequence: ctacggtaggtggcggagta. Inner Left Sequence: gcgtacttcctcgtctaccg. Inner Right Sequence: gcggaatcaggtcaagtgtt. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E11.9 Homozygous. Outer Left Sequence: atatcccaaccatcggaaca. Outer Right Sequence: gacacccgtttgcgtagttt. Inner Left Sequence: tttttctcggcgtacttcgt. Inner Right Sequence: gccacgtaggtaccttttgc. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46A5.2 Homozygous. Outer Left Sequence: tgtctccgtctccttttgct. Outer Right Sequence: tggcggttctgatatcttcc. Inner Left Sequence: ggcagaagtacgacgagagg. Inner Right Sequence: tggtaaaggccgatacgaac. Inner Primer PCR Length: 2189. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06G8.2 Homozygous. Outer Left Sequence: acaccttcacgatgaccctc. Outer Right Sequence: acatttgtacggcctggaag. Inner Left Sequence: acatggggaggcataatcaa. Inner Right Sequence: gtcatggacgtcaagagggt. Inner Primer PCR Length: 2873. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25E10.9a Homozygous. Outer Left Sequence: tcacggcattgtttgtgttt. Outer Right Sequence: caggcaaatgcactcttgaa. Inner Left Sequence: aaaaccactggaacactggc. Inner Right Sequence: tgtggagctgacttgtgagg. Inner Primer PCR Length: 2139. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21C3.2 Homozygous. Outer Left Sequence: tctcaccctacactgtcccc. Outer Right Sequence: ggaactgaagctgcatccat. Inner Left Sequence: cacatcggtgaatcacaagg. Inner Right Sequence: gctccaactcctgctattcg. Inner Primer PCR Length: 3007. Estimated Deletion Size: about 2250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22F7.5 Homozygous. Outer Left Sequence: gaaggaattcagggaaaggg. Outer Right Sequence: tactttttgggggtttgtcg. Inner Left Sequence: tcactggcgataacatccaa. Inner Right Sequence: tctgcgggaaaaatgatctc. Inner Primer PCR Length: 2746. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H13N06.6 Homozygous. Outer Left Sequence: aagcaggatcaggagcacat. Outer Right Sequence: atgagaagtgccgttgctct. Inner Left Sequence: catgtcattgatggctggac. Inner Right Sequence: gaacgccagttggttgattt. Inner Primer PCR Length: 2851. Estimated Deletion Size: about 850 bp. 12/2004: From Laura DiCaprio: The deletion is 981 base pairs from X: 15500754 - 15501734. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E11.3. Homozygous. Outer Left Sequence: TCAGTTTGGCCACATTTTGA. Outer Right Sequence: TCAGCGTGCTGTTCCTATTG. Inner Left Sequence: ATTCCGAAAGCTCGACAAGA. Inner Right Sequence: AAGAAGCCGGATTGGAAGTT. Inner Primer PCR Length: 3182 bp. Deletion Size: 1174 bp. Deletion left flank: CAAACAGCAAATAGCATTTTTCCACGACGA. Deletion right flank: CCCACCAAACCGAGGCAGCCATTCCGAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05E11.5 Homozygous. Outer Left Sequence: agccaaatttgaacacctgc. Outer Right Sequence: ttcgattccaaaagaggcat. Inner Left Sequence: agattgacgcccattacctg. Inner Right Sequence: cgaaaacctaaaagcatcgg. Inner Primer PCR Length: 2644. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.6 Homozygous. Outer Left Sequence: atgcggaataacggagtgtc. Outer Right Sequence: atcagtttgcagcttccgat. Inner Left Sequence: cgcgaattcacacacaaagt. Inner Right Sequence: tggcttctggagggatagtg. Inner Primer PCR Length: 2266. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29C4.8 Homozygous. Outer Left Sequence: actgactgccgctgatctct. Outer Right Sequence: cggatgactttttctctcgc. Inner Left Sequence: cgtagctcggagatgtcctc. Inner Right Sequence: tcattgaattgctgctctcg. Inner Primer PCR Length: 2632. Estimated Deletion Size: about 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11E3.6 Homozygous. Outer Left Sequence: GGCCCAACCTTTGAATTTTT. Outer Right Sequence: CCGTATCGATGTGAAACGTG. Inner Left Sequence: GAAGTTGCTGGAGTTGAGCC. Inner Right Sequence: CTTTGCCGAAGGAAACACAT. Inner Primer PCR Length: 2638. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52D10.2 Homozygous. Outer Left Sequence: tggcgagaaggaaagaaaga. Outer Right Sequence: aaacaaacaattgcgccttc. Inner Left Sequence: acaagcttcagagcgacgtt. Inner Right Sequence: tcttccttccttgccttcag. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20B5.3 Homozygous. Outer Left Sequence: caatgtcgtcaatggctacg. Outer Right Sequence: gttgttgaaggtaagcccca. Inner Left Sequence: taggaaatatccacgcgacc. Inner Right Sequence: cgaatttcaggcttctacgg. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04B4.2 Homozygous. Outer Left Sequence: tggcccttgtttaaatgctc. Outer Right Sequence: tcttaaccgttcggaaatcg. Inner Left Sequence: gtcgcgtcgcaacaatacta. Inner Right Sequence: ccaaggcaacaaaaggagaa. Inner Primer PCR Length: 2268. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08B4.6 Homozygous. Outer Left Sequence: ccggaagatgatgaaaggaa. Outer Right Sequence: acgtctcccagagagcgtaa. Inner Left Sequence: aagaacgtagcgcgagtgat. Inner Right Sequence: atacggtgtctatcgcggac. Inner Primer PCR Length: 2182. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25G6.4 Homozygous. Outer Left Sequence: ctctgcgcttcaagctctct. Outer Right Sequence: cagcagggaggtgtaccaat. Inner Left Sequence: gtgatgctcttgcccatttt. Inner Right Sequence: tgctctttttcaggaaggga. Inner Primer PCR Length: 3055. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02H5.7 Homozygous. Outer Left Sequence: gggatgggggatcagataat. Outer Right Sequence: aaatttgcatttgcctttgg. Inner Left Sequence: gttgctcactttatggggga. Inner Right Sequence: aatgccatgccatgtagtca. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55F8.3 Heterozygotes are WT and GFP+. Segregates very rare homozygous hT2 glowing animals. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: TACCAGTCAGAGTTGCCACG. Outer Right Sequence: GAATTGCGCCAATGAAGATT. Inner Left Sequence: TCAATTGCATTCCGTGATGT. Inner Right Sequence: GCGGAATTCGTGCTTTGTAT. Inner Primer PCR Length: 3397. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39A1C.2 Homozygous. Outer Left Sequence: ttttgaaaccggaaaattcg. Outer Right Sequence: tccaaaatttgttctgcacg. Inner Left Sequence: catcgaaaatccgcttcttt. Inner Right Sequence: agctgcagttccctttctca. Inner Primer PCR Length: 3022. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.3 Homozygous. Outer Left Sequence: tgcttcgattgattgctcac. Outer Right Sequence: ggaggttacgcatccaaaaa. Inner Left Sequence: tcggattttcctttgcattc. Inner Right Sequence: ttcgcctcctatatcccctt. Inner Primer PCR Length: 2845. Estimated Deletion Size: about 2050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y65B4BR.4a. Homozygous. Outer Left Sequence: AACGAAGAAGCGCAGGAGTA. Outer Right Sequence: CAATCGTCCACATCAACGTC. Inner Left Sequence: AGTTCAGAGGCATCCACGTC. Inner Right Sequence: ATCTCTGTACCGCCCTCCTT. Inner Primer PCR Length: 3219 bp. Deletion Size: 1042 bp. Deletion left flank: GCGGAGACCGGCGACAGCGAAGCGTGACAC. Deletion right flank: ACTCAGCCATTGCCACAGGGATGGGAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C55C2.1 Homozygous. Outer Left Sequence: gtcccatatgcttcttccca. Outer Right Sequence: aatccaagattcaaggcacg. Inner Left Sequence: tgtgaattgggtgagagcag. Inner Right Sequence: ttggcgtttttgtgtctctg. Inner Primer PCR Length: 2206. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04C12.5 Homozygous. Outer Left Sequence: tggcgagagaagaagagagg. Outer Right Sequence: aaacaatacctgattcggcg. Inner Left Sequence: gcgtgagaaacagtgcaaaa. Inner Right Sequence: aacatgacggtcagcaagtg. Inner Primer PCR Length: 2668. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC308.1 Homozygous. Outer Left Sequence: TGTTTGAATGGGGTTTCTCC. Outer Right Sequence: ACTTCCTGGTCGTTGTGGTC. Inner Left Sequence: ACAGGTGGTCAACCCATGAT. Inner Right Sequence: ACGAAGACTAGCACACGCAA. Inner Primer PCR Length: 3342. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H9.1 Homozygous. Outer Left Sequence: gatcgaagccaaagaacgaa. Outer Right Sequence: tgaggggacattcacacgta. Inner Left Sequence: tgggtactgtagtgggggtg. Inner Right Sequence: aaaggaggaacaaaatgggg. Inner Primer PCR Length: 2240. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24G7.5 Homozygous. Outer Left Sequence: GTCCACGTCAAGAGCACTCA. Outer Right Sequence: GACTCGAGCTCTTCGCTGAT. Inner Left Sequence: GAAAACCTGGATTCTTGCCA. Inner Right Sequence: GAACTGGCGACTTTTTGAGC. Inner Primer PCR Length: 3199. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.6 Homozygous. Outer Left Sequence: AGCATTTGGATATTGGCGAG. Outer Right Sequence: AGTGAACGGGAGATTTGTGC. Inner Left Sequence: TTGTGTGAAACCGATGTTGG. Inner Right Sequence: AGCCATCTCATCCTTTCCCT. Inner Primer PCR Length: 2975. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC504.2 Homozygous. Outer Left Sequence: tcgaccaatcaaaaatgcaa. Outer Right Sequence: cgcttacgtctgtcgtgcta. Inner Left Sequence: actcagccaacatcgtttcc. Inner Right Sequence: caccaggcaagttgagtgaa. Inner Primer PCR Length: 3051. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807