Search Strains

Y81G3A.3. Homozygous. Outer Left Sequence: TGTGGACCCGAAACAGTACA. Outer Right Sequence: AACACATCGGCTTCAATTCC. Inner Left Sequence: GGTTTCGGTGATGTCGTTCT. Inner Right Sequence: GTTTTCGGGATATTCGCAGA. Inner Primer WT PCR product: 2833. Deletion size: 1481 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E10A.21. Homozygous. Outer Left Sequence: TAAGCGGCTGAGCTATGGTT. Outer Right Sequence: AGACGACGAGAGAAACGAGC. Inner Left Sequence: AGTTTCCGTTGCCAATGAAC. Inner Right Sequence: TCCTTGTAGGCGTTTGTGTG. Inner Primer WT PCR product: 3078. Deletion size: 2103 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02A2.1. Homozygous. Outer Left Sequence: ATGTGATGTGATGCTGGGAA. Outer Right Sequence: TTGCTTTCTTTCGGCAAACT. Inner Left Sequence: CAATGCACCATATTTCACGC. Inner Right Sequence: ATCAGAAATTTGCCGGTTTG. Inner Primer WT PCR product: 2728. Deletion size: 1224 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25F6.4. Homozygous. Outer Left Sequence: CATAGCGACTGAAAAACGGG. Outer Right Sequence: GTTGAGCATGATGTGATGGC. Inner Left Sequence: TGGACGGAAACTTTGACACA. Inner Right Sequence: GGAATTCACCGTCCATGAGT. Inner Primer WT PCR product: 3323. Deletion size: 2974 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F9.2. Homozygous. Outer Left Sequence: CTTCACAGCTCATCCACCAG. Outer Right Sequence: GAAACGGGCAATTCAAGTGT. Inner Left Sequence: GGCAACTACACAGAAGCCGT. Inner Right Sequence: TAACAAAGCAGGGATGGGAG. Inner Primer WT PCR Product: 2503. Deletion size: 595 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01D3.5. Homozygous. Outer Left Sequence: GTGCTTGGCCAATTTTTCAT. Outer Right Sequence: CAGTTTTATCGGCGCTTCAT. Inner Left Sequence: TGAAACGCGGATAACATTGA. Inner Right Sequence: TCAGACAATGGAGGGGGTAA. Inner Primer WT PCR product: 2100. Deletion size: 1150 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y76A2B.6. Homozygous. Outer Left Sequence: GGGGAAATGGTGTGAGTGAT. Outer Right Sequence: ACCGATTCTCTGCATTCACC. Inner Left Sequence: TTCGGAACATACGGAGGAAG. Inner Right Sequence: TGAAACCCCTGGAGAAAATG. Inner Primer WT PCR product: 3043. Deletion size: 2533 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12A7.1. Homozygous. Outer Left Sequence: TGAACGCTGACCTGAGTTTG. Outer Right Sequence: ATCATATTCGTCTGGCGGAG. Inner Left Sequence: GACGCGATTTGTAGCCTAGC. Inner Right Sequence: GTCTCTTTGCCATGGATCGT. Inner Primer WT PCR product: 3269. Deletion size: 1719 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.2. Homozygous. Outer Left Sequence: TTTTTCAGGCGTTCCATTTC. Outer Right Sequence: TTATCAGTGCGGATCAACCA. Inner Left Sequence: GCAAAATCGCAAACCTGAAT. Inner Right Sequence: CGACACACATTCGATATGGC. Inner Primer WT PCR Product: 2884. Deletion size: 2524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13E6.6. Homozygous. Outer Left Sequence: TTACTTTGGCCACACCATCA. Outer Right Sequence: GCATTCAAGTCAAAGGGCAT. Inner Left Sequence: CGTAGTTTGCGCACTCACAT. Inner Right Sequence: TGTAGGGATGCTATCTGGGG. Inner Primer WT PCR product: 3285. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22A3.3. Homozygous. Outer Left Sequence: CGAAAGGGGAGTGGGTTACT. Outer Right Sequence: TTTGCACAGAATTCGCTCAC. Inner Left Sequence: ACATCTTAAAGGCGCACACC. Inner Right Sequence: CAGGAAAAAGAGGGAAAGGC. Inner Primer WT PCR product: 2631. Deletion size: 727 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32F2.1. Homozygous. Outer Left Sequence: ATCTACCAACACTGGGACGC. Outer Right Sequence: TTTCCAATTGAACCCCGTAA. Inner Left Sequence: AGTTGCAGTTGCAGGTGTTG. Inner Right Sequence: GGTCCGAGAGCTAGTTGCAC. Inner Primer WT PCR product: 3161. Deletion size: 1337 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28B3.1. Homozygous. Outer Left Sequence: TTCAAAATACCAAAAGCCGC. Outer Right Sequence: ATTGTTTCCACCGTTTTGGA. Inner Left Sequence: TTCTCATGTGCCCACACAAT. Inner Right Sequence: CAGTAATCCTCCTAGGCCCC. Inner Primer WT PCR product: 3046. Deletion size: 1112 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y81G3A.3. Homozygous. Outer Left Sequence: TGTGGACCCGAAACAGTACA. Outer Right Sequence: AACACATCGGCTTCAATTCC. Inner Left Sequence: GGTTTCGGTGATGTCGTTCT. Inner Right Sequence: GTTTTCGGGATATTCGCAGA. Inner Primer WT PCR product: 2833. Deletion size: 1179 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19F10.5. Homozygous. Outer Left Sequence: ACACCAGTTGCAATTCTCCC. Outer Right Sequence: AGTTTGGGTGAGAACCAACG. Inner Left Sequence: TTTCGCAGAATTTCGAGGAT. Inner Right Sequence: CTGTCGGCAAGAAGAAAAGG. Inner Primer WT PCR product: 2581. Deletion size: 2158 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26F1.10. Homozygous. Outer Left Sequence: TCTGATGCGTTTACAGTCGG. Outer Right Sequence: TTTTCTTGTTCAACGGCCTC. Inner Left Sequence: TTAAGCGGAGCACACTTCCT. Inner Right Sequence: GGCAATTGAAAATTGTTGCC. Inner Primer WT PCR product: 3182. Deletion size: 1786 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T17A3.8. Homozygous. Outer Left Sequence: AAAAACTCGGCGTTTGTTTG. Outer Right Sequence: TTTAAACGTCTCCCGGTACG. Inner Left Sequence: TTTGTACAACTGGCTCAGCG. Inner Right Sequence: ACTCAGCCATCAGATCCCAG. Inner Primer WT PCR product: 3128. Deletion size: 1543 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 615 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CTTTGCTCCGCCTATTTGAG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: CACCAACCGGTCTCAATTTT. Inner Primer WT PCR product: 2100. Deletion size: 1004 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3AM.6. Homozygous. Outer Left Sequence: GTCGCATTTCCGTTCATTTT. Outer Right Sequence: ACGTCTCATTACGGGATTCG. Inner Left Sequence: AAATGCCACGTCATGAAACA. Inner Right Sequence: TTTGGGTCCAGAAAAGCAAG. Inner Primer WT PCR product: 2766. Deletion size: 1184 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03D8.3. Homozygous. Outer Left Sequence: TTCAGGCAAATCCATCATCA. Outer Right Sequence: GCCGTTGATAAAGGAGGTCA. Inner Left Sequence: TTTTGCCACCAATTCCATCT. Inner Right Sequence: AGTCGTTGCAGACGTCAATG. Inner Primer WT PCR Product: 2959. Deletion size: 1382 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12H4.1. Homozygous. Outer Left Sequence: TGACGAAATCAAAATGCCAA. Outer Right Sequence: AATGAGGAAGACGAGCTCCA. Inner Left Sequence: ATCCCGACAAAATCGAAAAA. Inner Right Sequence: GTCGGGAATCTGATCTTCCA. Inner Primer WT PCR Product: 2816. Deletion size: 1315 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.1a. Homozygous. Outer Left Sequence: CAGAACGACTCGATCCACAA. Outer Right Sequence: AGCGGATAAAGTGCAGAACG. Inner Left Sequence: ATCCGATGGAAGTTGCAAAA. Inner Right Sequence: TACGCAGGCATCATGTTGTT. Inner Primer WT PCR product: 3116. Deletion size: 849 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26H9A.2. Homozygous. Outer Left Sequence: ATGTCGAAAATGCCCAAAAC. Outer Right Sequence: AAGTCTGAACCAGGGGTGTG. Inner Left Sequence: CCCTGAGCGAGCACTTATTC. Inner Right Sequence: CGTGTTCAAAACTGCAAGGA. Inner Primer WT PCR Product: 2824. Deletion size: 1250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52E12.2. Homozygous. Outer Left Sequence: AAGGTTTTGGAAAGATCGCA. Outer Right Sequence: CGACTTTCCTTGGAGCTCTG. Inner Left Sequence: CATTTGCTTCTTTTCCCTGC. Inner Right Sequence: GGCTCACATCTCCACAGTCA. Inner Primer WT PCR product: 3024. Deletion size: 1285 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01C8.3. Homozygous. Outer Left Sequence: AACGGTGCATTTTTCAGGAC. Outer Right Sequence: GGACGTTGAGAATGCGAAAT. Inner Left Sequence: AAATGGTTTACGGGCTTGG. Inner Right Sequence: ATGGTTGGCCATGTTGAGAT. Inner Primer WT PCR product: 2713. Deletion size: 629 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0024.10 Homozygous. Outer Left Sequence: TTGACGACGAACAGCTTGAC. Outer Right Sequence: TCAATCGAGCTTCACAGCAC. Inner Left Sequence: CATTTTGGCATAGCGGATTT. Inner Right Sequence: GTTTGTTGAAGCGAAGGAGC. Inner Primer WT PCR Product: 2517. Deletion size: 1140 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 1739 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 779 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.1 Homozygous. Outer Left Sequence: TAATGGGACAGAAAGGCACC. Outer Right Sequence: CTACTTGCTCCTCCGTCGAG. Inner Left Sequence: TTGACGCGCAAAATATCTCA. Inner Right Sequence: CAATGCCACAGAGAAAAGCA. Inner Primer PCR Length: 2951. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73F8A.25. Homozygous. Outer Left Sequence: AAAGTTGCAGTGGGGAAATG. Outer Right Sequence: AAGCGAATACGGATCATTGG. Inner Left Sequence: TTTCACGGAATTCTGGCTTC. Inner Right Sequence: TCTGAGCAAATTTTCCGCTT. Inner Primer WT PCR Product: 2305. Deletion size: 920 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

Hypomorphic allele. Temperature-sensitve Daf-c. Maintain at 15 C. Reference: Gerisch B, Antebi A. Development. 2004 Apr;131(8):1765-76.

Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.