Search Strains

R08B4.2. Homozygous. Outer Left Sequence: TGGGTGTTTGGACTGTGAAA. Outer Right Sequence: CATTGTGTATGCCCGAGTTG. Inner Left Sequence: TCCGGAACTTTCAGTTGGAG. Inner Right Sequence: CCATCATTTCCACCAGCTTT. Inner primer WT PCR product: 2668. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10B4.6. Homozygous. Outer Left Sequence: TCGTTTCTGACATGGCTCAC. Outer Right Sequence: ACCCATCCTTTCCCAATCTC. Inner Left Sequence: CGTATCCACGACCACAACAG. Inner Right Sequence: AGAATCTTCACACCAACGGG. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05E4.9. Homozygous. Outer Left Sequence: GTCAATAGTGCGACCGTCCT. Outer Right Sequence: CACAATGAGTTCTGCGGCTA. Inner Left Sequence: TCTGAGCCAAGAGTCGAGGT. Inner Right Sequence: GGTAGTCAAATCGGCTCCAA. Inner primer WT PCR product: 3099. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38C6.2. Homozygous. Outer Left Sequence: CCATCAACTAGTCGCCCAAT. Outer Right Sequence: ATGCCGCACCTATACCTTTG. Inner Left Sequence: TGATGTGAATCCTCCGTTCA. Inner Right Sequence: AGACAGTCAAAATGGACGCC. Inner primer WT PCR product: 3089. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F2.8. Homozygous. Outer Left Sequence: AGCGAAGAGTTTCCAACGAG. Outer Right Sequence: CAAACAAAGACGGGAAGGAA. Inner Left Sequence: ATTGATTGGAGTTGGCCTTG. Inner Right Sequence: CATCTCCAACCATGACACCA. Inner primer WT PCR product: 2778. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17H12. Homozygous. Outer Left Sequence: GAAATCCGCCTGAAAAATCA. Outer Right Sequence: GTGAAAACCAAGTGCAGGGT. Inner Left Sequence: AGCATTATCCCCGCATGTAG. Inner Right Sequence: AAACTGGGCGAGGGATTTAG. Inner primer WT PCR product: 2532. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.6. Homozygous. Outer Left Sequence: AAATGCAACAAGCCTCGAAC. Outer Right Sequence: ACCCACTTCTTCCACGTGTC. Inner Left Sequence: ATCCCTTGCAATTGTTGCTC. Inner Right Sequence: GTCGAGGGCTGACTTCTTTG. Inner primer WT PCR product: 3104. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46C3.3. Homozygous. Outer Left Sequence: TCTGTACGTTGTGGAGGCTG. Outer Right Sequence: CTGCTTTGCATGTTCTTGGA. Inner Left Sequence: ACTTCCTTTGGCACAACTGG. Inner Right Sequence: ATCGAATTGAACGCTGCTCT. Inner primer WT PCR product: 2848. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Upstream of the ORF of F53A2.4. Homozygous. Outer Left Sequence: ACCATTTCCTATTTTCCCCG. Outer Right Sequence: ATGGCTAACTTGGCATACGG. Inner Left Sequence: CCAGTTGTTCTCGGCTTCTC. Inner Right Sequence: GCACCATTGACATGTTTTCG. Inner primer WT PCR product: 1919. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F2.2A. Homozygous. Outer Left Sequence: attcaatcagcctgtggagg. Outer Right Sequence: tgctgctgctttctcgttta. Inner Left Sequence: gttggcttgctgccaataat. Inner Right Sequence: cctacaagtggcatgcgata. Inner primer WT PCR product: 2733. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28D9.3. Homozygous. Outer Left Sequence: CCACTCTGCTTGGTGTCTCA. Outer Right Sequence: GGTGATCTGGATCTGGAGGA. Inner Left Sequence: GTGCTCAATGCAGCAACAGT. Inner Right Sequence: CGTCTTCAGCATCACGAGAA. Inner primer WT PCR product: 2632. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30F8.4a. Homozygous. Outer Left Sequence: gacaagtttgttctgtcccat. Outer Right Sequence: cgtcatgttcctatatgctca. Inner Left Sequence: tgtctgtcacgagcataaatc. Inner Right Sequence: ttcttggaatacggtccttgt. Inner primer WT PCR product: 3500. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46A5.9. Homozygous. Outer Left Sequence: tcatttcttgcagcaattcgctgttaacactgcgagagcg. Outer Right Sequence: . Inner Left Sequence: attcgaatcgatgatggagc. Inner Right Sequence: aaattgaagttgcaaacccg. Inner primer WT PCR product: 2512. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32E10.7. Homozygous. Outer Left Sequence: CAGGAAACGTCTGTTCAGCA. Outer Right Sequence: CTCGTCTACAGTCGGAAGCC. Inner Left Sequence: TCTGCTCTTCCTCCAACACC. Inner Right Sequence: GTGGTCGATCAGGAATCGTT. Inner primer WT PCR product: 2879. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.8. Homozygous. Outer Left Sequence: aaaggttgagaacgccaaga. Outer Right Sequence: ctaggctgggctagggtagg. Inner Left Sequence: gcatcggagacagaaactcc. Inner Right Sequence: tctgtcttaggtgcctgcct. Inner primer WT PCR product: 2785. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C31C9.1a. Homozygous. Outer Left Sequence: AGGCCTTCAGCAAATCACAT. Outer Right Sequence: TCCCAATTTCCAGAATGAGC. Inner Left Sequence: ATCAATTCAACTCGTTCGCC. Inner Right Sequence: ATCGAGGTGACCGTGAAGAC. Inner primer WT PCR product: 2812. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F5.5. Homozygous. Outer Left Sequence: AAATTGTGAAACCGCACACA. Outer Right Sequence: TTGCAGCTATCCTGAACACG. Inner Left Sequence: TTCGGTAAGCCAAGTTGGAG. Inner Right Sequence: GGCGAGCAGTAGCACACATA. Inner primer WT PCR product: 2594. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H9.2. Homozygous. Outer Left Sequence: TGGTGGTGGTTCAAACTCAA. Outer Right Sequence: CGATGGCTAGAACACCCATT. Inner Left Sequence: ATCACAAACCAATTGGGGAA. Inner Right Sequence: GAGTCTGGCCGGTGTAGTGT. Inner primer WT PCR product: 3154. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02E9.3. Homozygous. Outer Left Sequence: TTGAAACACGAGTGGGCATA. Outer Right Sequence: CTTCCACGCTTTCCTATTGC. Inner Left Sequence: AGCAGATCAGGAACGCAACT. Inner Right Sequence: TTGGTTTAATCGTCATGCCA. Inner primer WT PCR product: 2869. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B3.4. Homozygous. Outer Left Sequence: GCTGGCATTGTTTCCAGAAT. Outer Right Sequence: GGCTACCACATTGTCCGAGT. Inner Left Sequence: AAGTGTCGAAACACGGGAGA. Inner Right Sequence: TAAAGATTGGCCCGCACTAC. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27A8.2. Homozygous. Outer Left Sequence: ATCGAATACATCCGTCCAGC. Outer Right Sequence: TCTTGACCCAGAAACGAACC. Inner Left Sequence: GGCAACATACCATTTCCACC. Inner Right Sequence: TGACCCAGAAACGTACCCAT. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05A12.2. Homozygous. Outer Left Sequence: CGACTTGGAATAGTTGCCGT. Outer Right Sequence: ACCACCCTATGTTCTGTGCC. Inner Left Sequence: GTGAACCGCATGAAGAGACA. Inner Right Sequence: GTTTGGTGCGATGGAACTCT. Inner primer WT PCR product: 2568. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E4.3, T27E4.8. Homozygous. Outer Left Sequence: TGGCATTCCTTCCTTATTGC. Outer Right Sequence: TGAGAAGCCGAGTAGCTGGT. Inner Left Sequence: GTAAGGCTTTCTGCCGTTTG. Inner Right Sequence: TGAGGGCCCTGTAGAAGTTG. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09C8.1. Homozygous. Outer Left Sequence: CGTTGGTAATGAGCACGATG. Outer Right Sequence: AGAACGAGTTGCGAATACGG. Inner Left Sequence: GTGTTGTGTCTTGGCATTGG. Inner Right Sequence: AAGGATGCCTTGTTGAGTGG. Inner primer WT PCR product: 2885. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner Primer WT PCR Product: 2904. Deletion size: 531 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B3.8. Homozygous. Outer Left Sequence: ATTGGTGTCGCTTTCCTTTG. Outer Right Sequence: TGTACGGGTTCGAACATTCA. Inner Left Sequence: TCTGCATGTGGGAAGACGTA. Inner Right Sequence: GAGGCAATGGTCAGAGAAGC. Inner primer WT PCR product: 2708. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F36D4.3. Homozygous. Outer Left Sequence: AGCATCCAATATGGACGGAG. Outer Right Sequence: ACGTTTGGCAAGCCATTTAC. Inner Left Sequence: CGGATAAGGCTCGAAGATGA. Inner Right Sequence: ACGTCTCGCCAAATATCCAC. Inner primer WT PCR product: 2679. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK430.5. Homozygous. Outer Left Sequence: AGCCAATTATTCGGAAGCCT. Outer Right Sequence: GCCTCCTCACCTTGACTCAG. Inner Left Sequence: TGGCAGTATTTCTCGTGCAG. Inner Right Sequence: TCGAAGAATTCGGCTCAGTT. Inner primer WT PCR product: 3291. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07F10.1. Homozygous. Outer Left Sequence: GGAAATCGATTGCATTCACC. Outer Right Sequence: TCAATTCGGTCAAAGGCTCT. Inner Left Sequence: TGAACCTGCATACAAAGCCA. Inner Right Sequence: TGTTTCCCTCCAAGTAACGG. Inner primer WT PCR product: 2758. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H3.7. Homozygous. Outer Left Sequence: AAATGGCGATTCAAAGTTCG. Outer Right Sequence: TCTTTGCCACGTGACTGTTC. Inner Left Sequence: AACATCCGGGAAATCATCAA. Inner Right Sequence: CCCGTGGAATTTAAGACGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10E11.6. Homozygous. Outer Left Sequence: TTGAAACGCCGATATCATCA. Outer Right Sequence: AGCGATGTTGGAATAAACGC. Inner Left Sequence: CCCACATTCCAAATAAACCG. Inner Right Sequence: TTCGTAGTAGGCGCTGGATT. Inner primer WT PCR product: 2829. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1022.3, D1022.4. Homozygous. Outer Left Sequence: ACATGGCCGGTATTCTGGTA. Outer Right Sequence: TACGCAGACAACGTCAAACC. Inner Left Sequence: GGCGATGGACTACAACAGGT. Inner Right Sequence: CAGCTTTCCGAGGAATTACG. Inner primer WT PCR product: 2467. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42G9.9a. Homozygous. Outer Left Sequence: CCTCCTACCACCCATCTGAA. Outer Right Sequence: CAACATGCTCAGGGAAGTCA. Inner Left Sequence: TGAACCGAAGCCTAAACCAG. Inner Right Sequence: CTGGAAATTTGTTGGGCAGT. Inner primer WT PCR product: 2452. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807