Search Strains

C41C4.1. Homozygous. Outer Left Sequence: CACCAGAAATTGAGCAAGCA. Outer Right Sequence: CCCTCGTCCATTTGCTACAT. Inner Left Sequence: TTGCATTTCGATTGGCATAA. Inner Right Sequence: CCCTGGTGATAACACGGTTT. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.3, T27E9.4. Homozygous. Outer Left Sequence: GAAACTCAACTTCTTCGCCG. Outer Right Sequence: TCCGGTATACGCAAATGACA. Inner Left Sequence: ATGTCCGCTATGTTCAAGGG. Inner Right Sequence: TCATGTTGGCTTCCATCAAA. Inner primer WT PCR product: 2658. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29D10.4. Homozygous. Outer Left Sequence: AGTGCATGCAAACAGCACTC. Outer Right Sequence: CAGTAAATACGCCGGTGGTT. Inner Left Sequence: CCAACCAGGGACTGAAGTGT. Inner Right Sequence: GTCAATGTTCAGCATGTCGG. Inner primer WT PCR product: 3054. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C37E2.5. Homozygous. Outer Left Sequence: CACCCAACGGAACTCTTGT. Outer Right Sequence: GGTACACGAGCATGGGTCT. Inner Left Sequence: CGGAAATCGCAATGTAATC. Inner Right Sequence: TAAATTCGACTCGGGCTTT. Inner primer WT PCR product: 2900. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52F12.6. Homozygous. Outer Left Sequence: ACGGATGGAACAGGTGACTC. Outer Right Sequence: TCATGATGGATTGGCTGAAA. Inner Left Sequence: TTGGGAAATTTGGAAACTGG. Inner Right Sequence: TATGAAACAAATGCTGGCGA. Inner primer WT PCR product: 3150. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23H5.3, C23H5.8. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2595. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05H5.1. Homozygous. Outer Left Sequence: AGCTCTCGTCATCGAGCATT. Outer Right Sequence: TTCGACATGCTCTCCAACAG. Inner Left Sequence: TTTGAATTTCTCACGGAACG. Inner Right Sequence: AGACGAACCCAAAATGATCG. Inner primer WT PCR product: 3326. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0336.6. Homozygous. Outer Left Sequence: GATACAATTCCCACGCCTTG. Outer Right Sequence: GGAAGGCGGAATGAGTGTTA. Inner Left Sequence: GCAGTGAGAGAACGAGCACA. Inner Right Sequence: CGAGTCATGCGAATCTTCAA. Inner primer WT PCR product: 2654. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27E11.1. Homozygous. Outer Left Sequence: AAGGGATGCAGATGATGGAG. Outer Right Sequence: TGCAGGCCTTCAGAACTTTT. Inner Left Sequence: AACCGGGAAGGAGTTACGAT. Inner Right Sequence: TCATGGACTGTGGCAGTAGC. Inner primer WT PCR product: 2891. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27D12.2. Homozygous. Outer Left Sequence: ATAAGGGCAATGAGCACAGG. Outer Right Sequence: TGAGCTCACGCCAGAATATG. Inner Left Sequence: CTCCAACCACGGCATAAAGT. Inner Right Sequence: TCTACGGCTTATAGCTCGGC. Inner primer WT PCR product: 3227. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13G10.2. Homozygous. Outer Left Sequence: TCCCGAGTATTTCGGCTATG. Outer Right Sequence: TACGTAGCATCACCATCCGA. Inner Left Sequence: TGACAACCGATGCTTCTCTG. Inner Right Sequence: ATACCGACGAATCGATCAGC. Inner primer WT PCR product: 3023. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03A3.2. Homozygous. Outer Left Sequence: CACACGTTTTCGCATTTCAC. Outer Right Sequence: GGAGCGTACTTGCCACATTT. Inner Left Sequence: GCCAACTCTCCAGAAACCAA. Inner Right Sequence: TTTCAGAGATGAGCTCGGGT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57C7.2. Homozygous. Outer Left Sequence: ATCGCATGGACACCATCATA. Outer Right Sequence: TTGACTGGAAATGGAGGAGG. Inner Left Sequence: GGGCTTTCAAACATTACCGA. Inner Right Sequence: CGGTGTACAGCTTACTCGCA. Inner primer WT PCR product: 3059. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D3.4. Homozygous. Outer Left Sequence: ATGTCTAGGCGGTGGAGAGA. Outer Right Sequence: TGGGTGTTTGTGGTTGAAGA. Inner Left Sequence: GCAGTGTCGGCTGCTAATTT. Inner Right Sequence: TTTCTGAAACCCGTAGGACG. Inner primer WT PCR product: 2309. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13H5.2. Homozygous. Outer Left Sequence: AGCTGGAAGAGGTTTGTGGA. Outer Right Sequence: CAACTTCAGGCTCCAGCTTC. Inner Left Sequence: TTTAGGTCCAGTGCTCGGTC. Inner Right Sequence: CCGAATTCGTTGATTCTGGT. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54A3.4. Homozygous. Outer Left Sequence: ATAGAAAATGCGAGAGCGGA. Outer Right Sequence: GCCTGCCTACCATTAAAGCA. Inner Left Sequence: TGTGCAGGGTGTCTCATTGT. Inner Right Sequence: TTGAAATTTCTCGGGGTACG. Inner primer WT PCR product: 2859. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14B8.1. Homozygous. Outer Left Sequence: TTCCATTGCTTCCCTCAATC. Outer Right Sequence: ATGGCAAGGGTGGTAGTGAC. Inner Left Sequence: ATTCCCAACATTTTCCACCA. Inner Right Sequence: TTGGCTGGGATGATTCTTTC. Inner primer WT PCR product: 2944. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06C6.5. Homozygous. Outer Left Sequence: TGAGGACACTCTCGCGTATG. Outer Right Sequence: CGCACACCTAACCATGACAC. Inner Left Sequence: AAATGTGAAATCTTTGCCGC. Inner Right Sequence: GTGCACCCGAGATCAAAAAG. Inner primer WT PCR product: 2464. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50H2.2. Homozygous. Outer Left Sequence: GATATGCTCATGTGGCATCG. Outer Right Sequence: AGATCGATGAGTGTGGAGGG. Inner Left Sequence: ATGCCATCTTTTTCAAACGG. Inner Right Sequence: GGAAGACCTGATTGGGTTGA. Inner Primer WT PCR Product: 2549. Deletion size: 966 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H2.4. Homozygous. Outer Left Sequence: TGATCCAATGAAAGGCAACA. Outer Right Sequence: TCTTGCAAAATGATCCCCTC. Inner Left Sequence: GCGGATATTTTTGGGAGTGA. Inner Right Sequence: CTGCTCTCGGATTTCGTAGG. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0393.5. Homozygous. Outer Left Sequence:GTTCACCTGGATGGATTGGT. Outer Right Sequence:GCGAGTTCAAATTTTCGAGG . Inner Left Sequence: AAATTCAAAGGCAGCACCAC. Inner Right Sequence: TTCCGCAAAATCCAAAAATC. Inner primer WT PCR product: 3110. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42F12.2. Homozygous. Outer Left Sequence: TTTGTTTCGGGTAAAGCCAC. Outer Right Sequence: TTGCGCCCTCTAGAAACACT. Inner Left Sequence: TTTGTCTTGCCCCACCTAAC. Inner Right Sequence: AGCAAAGCAAAGGGCAACTA. Inner primer WT PCR product: 2229. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807