Search Strains

dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929.

Unc and Vul.

Vul and Unc.

Maintain at 15C. Vulvaless. Temperature-sensitive constitutive dauer (Daf-c) at 25C.

Vul and Unc.

waEx15 [fat-7::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons. Null allele of scrm-1: 2501 bp deletion and 7 bp insertion (CACACAT) removes the entire scrm-1 coding sequence (position 11688933 - 11691433 of chromosome I).

Vulvaless.

Animals which have lost the Dup are thin, sterile, and uncoordinated. Maintain by picking WT (Egl).

Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.

muIs35 [mec-7::GFP + lin-15(+)].

muIs62 [mig-13p::mig-13::GFP + lin-15(+)].

muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect.

muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.

muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.

muIs32 [mec-7p::GFP + lin-15(+)]. Superficially wild-type. Reference: Ch'ng, Q et al. (2003) Geneteics 164:1355-67.

zaIs2 [lin-14::GFP + rol-6(su1006)]. Rollers, though Rol is not completely penetrant, Reference: Olsson-Carter K, Slack FJ. PLoS Genet. 2010 Aug 5;6(8). pii: e1001054.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs104 [str-1p::GFP] X. AWB expression of GFP.

kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs121 [unc-115::GFP + lin-15(+)]; autosomal. Maintain under normal conditions. Reference: Lundquist E, et al. (1998) Neuron 21(2):385-92.

kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.

kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389).

kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.

kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.

Viable. Can be scored only using special neuronal markers such as zdIs5 [mec-4p::GFP + lin-15(+)], which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.

kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.

kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].