Search Strains

Class I allele. Complete loss of gut granules (birefringence) in intestinal cells and mislocalization of birefringent material into the intestinal lumen. Reference: Rabbitts et al. (2008) Genetics 180:857-871.

Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.

Butanone enhancement abnormal. Dyf. Weak Dpy. Allelic to bbs-8(nx77).

From Beauchêne (Eure & Loir -France), in the cabbage parcel, 12 Sep 03. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated on May 6, 2005 from soil with freshly added compost in a cabbage field in Chengyang Village, 20 km north of Sanjiang, Guangxi, China. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

ts embryonic lethal. Grows at 15C, 20C. Lethal at 25C. [Also contains a temperature sensitive lin-12 hypomorphic allele called ar170. Has 2 anchor cells. Jane Hubbard, 3/96 See WBPaper00002483. See GS1369 for emb-5 reference strain.]

Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.

Use as a replacement strain for SP457. Rubberband Unc.

Weak Rubberband.

Class 3 (neomorphic) allele. Uncoordinated, rubberband paralysis like unc-93(e1500). Suppressed by intragenic revertants and unc-93 alleles.

Rubberband Unc. Muv.

Wild type. n1412 loss-of-function suppresses the e1500sd rubberband phenotype.

Wild type. n1415 loss-of-function suppresses the e1500sd rubberband phenotype.

Non-rubberband. Muv.

Dpy. unc-93(n1415) loss-of-function suppresses the sup-9(n1550) Rubberband phenotype.

n765 is temperature-sensitive Muv. Loss-of-function of sup-10(e2127) suppresses the sup-9(n1550) Rubberband mutation.

Weak Rubberband.

Heterozygotes are Unc (Rubberband) and segregate Unc, DpyUnc and early larval lethals (nDf6 homozygotes). Maintain by picking Unc non-Dpy.

Hets are Unc(Rubberband) and Egl. Segregate Unc, DpyUnc and early larval lethals (L1). Maintain by picking Uncs. Received new stock 1/3/94.

Hets are Unc(Rubberband) and Egl. Segregate Unc, DpyUnc, and dead eggs. Maintain by picking Uncs.

Hets are Unc (Rubberband) and Egl. Segregate Unc, DpyUnc and dead eggs. Maintain by picking Uncs. CGC received new stock 8/98.

Heterozygotes are Unc(Rubberband) and Egl, and segregate Unc, DpyUnc and dead eggs. Maintain by picking Unc.

Wild type phenotype. e1500 rubberband phenotype is suppressed by the loss-of-function n234 mutation.

Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.

Short swollen, bubbly excretory canal (resembles rh90).

Chubby (short and fat--analogous to C. elegans Dpy phenotype). Parental strain is Caenorhabditis briggsae G16. Males are chubby, therefore cby-3 is X-linked.

From C. briggsae G16. Chubby. Self-progeny 14% male. mih-1 is autosomal.

From C. briggsae G16. Chubby. 16% of self-progeny are males. bd103 is autosomal.

From C. briggsae G16. Chubby. 8% of self-progeny are males.

mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.

Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Reference: Simske JS, et al. Nat Cell Biol. 2003 Jul;5(7):619-25.

F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2  arrested larvae (ve975 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+.  Left flanking Sequence: acgaaaaaagacccagaaaaaatggagaaa; Right flanking sequence: ATATTAATAATAATGAGCTCCGATCGCTCG. eif-2Bbeta crRNA A: aaCGGGGGGTACAAGTTATG; eif-2Bbeta crRNA B: CGGCTTAATGATCACGAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Rubberband Unc. Reverts. There is some question regarding e1500 in this strain. Please see MT19321 as a better strain.

F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTTCAAAAAGTCCCTCTGCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: TTATGTGAGGCTTCGACACG. Internal WT amplicon: 1741 bp. Deletion size: 712 bp. Deletion left flank: GATAATGTCGAACTTGCAAATGTATTTTCG. Deletion right flank: TTAAAAGAAAGACAATGGAGAATCAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01H10.6. Superficially wild type. External left primer: ACTTCGGTAAATCGACACCG. External right primer: TGTCCGAAGTGGTTTCATCA. Internal left primer: TTCGAGACGGTAAATCAGCC. Internal right primer: GAACCTACTCGCAGGGTGTC. Internal WT amplicon: 1513 bp. Deletion size: 692 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105E8A.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H4. Isolated from pill bug in a Chinese cabbage field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.