Search Strains

More Fields
Strain Species Genotype Add
OH14220 C. elegans hpl-2(ot860 [hpl-2::mKate2]) III. Show Description
ot860[hpl-2::mKate2]. Grows normally at 15-20C. Endogenous hpl-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 96; tags both isoforms of hpl-2. This tag was based on a published hpl-2 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.
OH14335 C. elegans otIs637. Show Description
otIs637 [bnc-1p::rab-3::GFP + myo-2p::mCherry]. Reporter for presynapse of VA/VB class motor neurons innervating muscle and DD motor neurons in ventral nerve cord. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14405 C. elegans tab-1(gk753) II; otIs549 X; otEx6747. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14429 C. elegans pals-22(ot811) III; otIs381 V; otEx6769. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14454 C. elegans otIs587; otIs304. Show Description
otIs587 [gcy-5(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry]. otIs304 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. GFP reporter tag inserted into gcy-5(+) fosmid. gcy-5 is normally expressed in ASER and RIGL/R neurons, but upon heatshock, expression of CHE-1 induces ectopic gcy-5 expression (the extent of ectopic expression is dependent on the timing of the heatshock). Reference: Patel T & Hobert O. eLife 2017.
OH14486 C. elegans gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. Show Description
ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).
OH14546 C. elegans pha-1(e2123) III; otEx6802. Show Description
otEx6802 [lgc-37p::GFP + pha-1(+)]. Maintain at 25C to select for maintain array. Reporter contains 5 kb of lgc-37 promoter fused with GFP. Derived from injection of pMG249; line 5. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14547 C. elegans pha-1(e2123) III; otEx6803. Show Description
otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14548 C. elegans tab-1(gk753) II; otIs549 X; otEx6804. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14589 C. elegans daf-12(ot870[daf-12::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14619 C. elegans elt-1(ok1002) IV; him-5(e1490) V; otIs549 X; otEx6751. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva U. et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586; PMCID: PMC8099054.
OH14660 C. elegans snf-3(ok293) II; him-5(e1490) V. Show Description
Him. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
OH14674 C. elegans otIs348 IV; him-5(e1490) V. Show Description
otIs348 [unc-47p::mChopti::unc-54 3'UTR + pha-1(+)] IV. Him. otIs348 contains 300 bp upstream of the unc-47 start codon; derived from injection of pMG92; line 2-16. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14675 C. elegans otIs575 I; him-5(e1490) V. Show Description
otIs575 [unc-46p::GFP + pha-1(+)] I. Him. otIs575 contains 234 bp upstream of the unc-46 start codon; derived from injection of pMG117; line 17-2. Integrated in LG I near ceh-8 and ceh-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14711 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx5999. Show Description
otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14712 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx6001. Show Description
otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14783 C. elegans kyIs140 I; oig-8(ot818) II; otTi20. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.
OH14785 C. elegans kyIs140 I; oig-8(ot818) II; otTi22. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
OH14861 C. elegans lite-1(ce314) X; otIs644. Show Description
otIs644 [tdc-1::ChR2::YFP]. Reporter contains 4.4 kb of tdc-1 promoter fused to ChR2::YFP; can be used for optogenetic stimulation of tyraminergic and octopaminergic neurons.
OH14864 C. elegans kyIs140 I; oig-8(ot818) II; otTi24. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID*]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva U et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14891 C. elegans daf-12(ot874[daf-12::TagRFP::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-12 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14892 C. elegans daf-3(ot875[daf-3::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14896 C. elegans daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-3 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14926 C. elegans bnc-1(ot721) vsIs33 V. Show Description
vsIs33 [dop-3::RFP] V. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14946 C. elegans ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14984 C. elegans daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14986 C. elegans ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14989 C. elegans ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH15034 C. elegans otIs653. Show Description
otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH15205 C. elegans otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
OH15262 C. elegans otIs669 V. Show Description
otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15263 C. elegans otIs670 V. Show Description
otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15285 C. elegans pha-1(e2123) III; otEx7116. Show Description
otEx7116 [inx-1a(fosmid WRM0672aB09f)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH15363 C. elegans otIs669 him-5(e1490) V Show Description
High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15422 C. elegans ceh-14(ot900) X. Show Description
Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.
OH15430 C. elegans pha-1(e2123) III; otIs669 V. Show Description
Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15439 C. elegans ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15493 C. elegans pha-1(e2123) III; otIs669 V; otEx7202. Show Description
otEx7202 [gbb-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15495 C. elegans otIs696. Show Description
otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15499 C. elegans pha-1(e2123) III; otIs669 V; otEx7206. Show Description
otEx7206 [mgl-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15500 C. elegans otIs669 V; otIs672. Show Description
otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15511 C. elegans pha-1(e2123) III; otIs669 V; otEx7209. Show Description
otEx7209 [gar-2(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15518 C. elegans pha-1(e2123) III; otIs669 V; otEx7215. Show Description
otEx7215 [mgl-3(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15519 C. elegans pha-1(e2123) III; otIs669 V; otEx7216. Show Description
otEx7216 [gar-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15528 C. elegans him-5(e1490) V; otIs696. Show Description
High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2