Strain Information
| Name | PD8119 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | smg-1(cc545) I. |
| Description | Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
| Mutagen | EMS |
| Outcrossed | x2 |
| Made by | Getz and Fire |
| Laboratory | PD |
Sign in
or
register an account if you want to order this strain.