Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.

RNAi deficient. Transposon high-hopper strain. Him. Weak sterility.

vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs53 [rps-27p::mNeonGreen::Flag::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. mNG::NRDE-3 localizes to the cytoplasm. Upon introduction of dsRNA, mNG::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs54 [eef-1A.1p::YFP::nrde-3::SL2::sid-1] II. YFP::NRDE-3 localizes to the cytoplasm in most somatic tissues and upon exposure to dsRNA targetting a gene, moves to the nucleus in cells expressing the transgene. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

Reference: Guang S, et al. Nature. 2010 Jun 24;465(7301):1097-101.

T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.

ggIs28 [nrde-3p::3xFlag::GFP::nrde-2 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.