| MT16061 |
C. elegans |
mir-238(n4112) III; nDf62 X. Show Description
4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT16133 |
C. elegans |
set-24(n4909) II. Show Description
Reference: Development 134(16):2991-9 (2007).
|
|
| MT162 |
C. elegans |
egl-18(n162) IV. Show Description
Egg laying defective. Retains late stage eggs. Vulva abnormalities.
|
|
| MT16308 |
C. elegans |
mir-252(n4570) II. Show Description
Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16309 |
C. elegans |
mir-247&mir-797(n4505) X. Show Description
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16310 |
C. elegans |
mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16311 |
C. elegans |
mir-77(n4286) II. Show Description
Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16316 |
C. elegans |
mir-355(n4618) II. Show Description
Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16317 |
C. elegans |
mir-252(n4570) II; mir-251(n4606) X. Show Description
Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16335 |
C. elegans |
mir-251(n4606) X. Show Description
Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16336 |
C. elegans |
mir-86(n4607) III. Show Description
Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16337 |
C. elegans |
mir-245(n4798) I. Show Description
Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16426 |
C. elegans |
set-9(n4949) IV. Show Description
F15E6.1 Tandem deletion/duplication.
|
|
| MT16429 |
C. elegans |
set-6(tm1611) lin-15A(n767) X. Show Description
Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
|
|
| MT16430 |
C. elegans |
set-6(tm1611) lin-15B(n744) X. Show Description
Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
|
|
| MT16471 |
C. elegans |
mir-60(n4947) II. Show Description
Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16494 |
C. elegans |
mir-229&mir-64&mir-65&mir-66(nDf63) III. Show Description
Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16506 |
C. elegans |
mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16529 |
C. elegans |
lin-61(n3447) I; lin-15A(n767) X. Show Description
SynMuv B. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT16530 |
C. elegans |
lin-61(n3447) I; lin-8(n2731) II. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT16532 |
C. elegans |
lin-61(n3447) I; lin-38(n751) II. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT16696 |
C. elegans |
mir-244(n4367) I. Show Description
Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT16846 |
C elegans |
csp-1(n4967) II. Show Description
n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
| MT16848 |
C. elegans |
mir-249(n4983) X. Show Description
Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT170 |
C. elegans |
egl-27(n170) II. Show Description
Egg laying defective. Retains late stage eggs. Males do not mate.
|
|
| MT171 |
C. elegans |
egl-34(n171) I. Show Description
Egg laying defective. Retains late stage eggs.
|
|
| MT17121 |
C. elegans |
set-17(n5017) II. Show Description
Reference: Development 134(16):2991-9 (2007).
|
|
| MT17136 |
C. elegans |
nDf67 IV; nDf58 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17137 |
C. elegans |
mir-51(n4473) IV; nDf58 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17143 |
C. elegans |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. Show Description
Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17428 |
C. elegans |
mir-72(n4130) II; nDf47 X. Show Description
Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17429 |
C. elegans |
nDf67 IV. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17446 |
C. elegans |
mir-53(n4113) mir-52(n4100) IV; nDf58 X. Show Description
Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT17463 |
C. elegans |
set-25(n5021) III. Show Description
Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).
|
|
| MT17631 |
C. elegans |
nDf56 IV; nDf60 V. Show Description
Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17676 |
C. elegans |
mir-45(n4280) II; nDf59 V; mir-247(n4505) X. Show Description
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT17810 |
C. elegans |
mir-1(n4102) I. Show Description
Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT17997 |
C. elegans |
mir-235(n4504) I. Show Description
Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT18016 |
C. elegans |
nDf63 III; mir-63(n4568) X. Show Description
Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
|
|
| MT18023 |
C. elegans |
lin-4(e912) II; mir-237(n4296) X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT18043 |
C. elegans |
mir-240&mir-786(n4541) X. Show Description
Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT18143 |
C. elegans |
nIs286 X. Show Description
nIs286 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18144 |
C. elegans |
nIs287 X. Show Description
nIs287 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18145 |
C. elegans |
nIs289 X. Show Description
nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
|
|
| MT18409 |
C. elegans |
nDf53 III; mir-58.1(n4640) IV. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT18410 |
C. elegans |
mir-58.1(n4640) IV; nDf54 X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT19075 |
C. elegans |
nIs352. Show Description
nIs352 [eya-1p::GFP::eya-1 + rol-6(su1006)]. Rollers. Rescuing array was integrated in eya-1(tm759) background. Reference: Hirose T, Galvin BD, Horvitz HR. Proc Natl Acad Sci U S A. 2010 Aug 31;107(35):15479-84.
|
|
| MT1908 |
C. elegans |
nDf21/dpy-19(e1259) unc-32(e189) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUncs and dead eggs.
|
|
| MT1909 |
C. elegans |
nDf22/dpy-19(e1259) unc-32(e189) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs. e1259 has a ts maternal effect.
|
|
| MT19110 |
C. elegans |
nIs363 X. Show Description
nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]
|
|
