| MT12958 |
C. elegans |
mir-87(n4104) V. Show Description
Deletion breakpoints are:CACACACACACACACATACATA / CATACATACAT...CACACAGCCAAAA / GGGGCGGGACGACGACTCCTCCCCGCCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12969 |
C. elegans |
mir-259(n4106) V. Show Description
Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12979 |
C. elegans |
mir-70(n4110) V. Show Description
Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12983 |
C. elegans |
mir-238(n4112) III. Show Description
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12989 |
C. elegans |
mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12990 |
C. elegans |
mir-52(n4114) IV. Show Description
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12993 |
C. elegans |
mir-71(n4115) I. Show Description
Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12999 |
C. elegans |
mir-85(n4117) II. Show Description
Deletion breakpoints are:TCATCTGATGACTTATCTTCA / TACTCGTGT...AACGTGATGAA / GGTCCGGATAGGGCTTGAGCTATTCGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13015 |
C. elegans |
mir-72(n4130) II. Show Description
Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13078 |
C. elegans |
mir-73&mir-74(nDf47) X. Show Description
Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13113 |
C. elegans |
tdc-1(n3419) II. Show Description
n3419 is a deletion in L-aromatic amino acid decarboxylase with homology to histadine decarboxylase. Forages while backing. PKA adc-1.
|
|
| MT13231 |
C. elegans |
nDf48 II. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT13292 |
C. elegans |
mir-124(n4255) IV. Show Description
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13372 |
C. elegans |
nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13406 |
C. elegans |
mir-34(n4276) X. Show Description
Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13433 |
C. elegans |
mir-45(n4280) II. Show Description
Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13544 |
C. elegans |
ceh-30(n4289) X. Show Description
Reference: Schwartz HT & Horvitz HR (2007) Genes Dev 21(23):3181-94.
|
|
| MT13652 |
C. elegans |
mir-48(n4097) V; mir-84(n4037) X. Show Description
Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle.
|
|
| MT13653 |
C. elegans |
mir-237(n4296) X. Show Description
Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13897 |
C. elegans |
mir-241(n4316) V. Show Description
Superficially WT. Deletion is in cosmid F56A12 from 7299-7756. mir-241 is at 7661-7681.
|
|
| MT13949 |
C. elegans |
mir-80(nDf53) III. Show Description
Deletion breakpoints are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / GATTAGGAGAGTATAGACATCGAAAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13952 |
C. elegans |
lgc-53(n4330) X. Show Description
1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.
|
|
| MT13954 |
C. elegans |
mir-81&mir-82(nDf54) X. Show Description
Deletion breakpoints are: AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1401 |
C. elegans |
+/szT1 [lon-2(e678)] I; nDf19/szT1 X. Show Description
Hets are WT and throw WT, dead eggs and Lon males. Maintain by picking WT.
|
|
| MT14091 |
C. elegans |
mir-79(n4126) I. Show Description
Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14117 |
C. elegans |
mir-2(n4108) I; nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14118 |
C. elegans |
mir-241(n4315) V; mir-84(n4037) X. Show Description
Superficially WT.
|
|
| MT14119 |
C. elegans |
nDf50 II. Show Description
Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14128 |
C. elegans |
nDf53 III; nDf54 X. Show Description
Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.
|
|
| MT1434 |
C. elegans |
egl-30(n686) I. Show Description
Egg-laying defective. Retains late stage eggs. Semi-dominant. Unc-slow moving.
|
|
| MT14347 |
C. elegans |
mir-273(n4438) II. Show Description
Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1442 |
C. elegans |
mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT.
|
|
| MT1443 |
C. elegans |
egl-10(n692) V. Show Description
Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C. Semidominant. Males mate. Sluggish and weak kinker.
|
|
| MT14446 |
C. elegans |
mir-228(n4382) IV. Show Description
Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14448 |
C. elegans |
mir-79(n4126) I; mir-75(n4472) X. Show Description
Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
|
|
| MT14449 |
C. elegans |
mir-232(nDf56) IV. Show Description
Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1445 |
C. elegans |
egl-35(n694) III. Show Description
Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
|
|
| MT14450 |
C. elegans |
mir-51(n4473) IV. Show Description
Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14451 |
C. elegans |
mir-76(n4474) III. Show Description
Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14452 |
C. elegans |
mir-46(n4475) III. Show Description
Deletion breakpoints are:CTATGAATGTTTAAAA / AAAAAAATTTTTTGAAAAGTAAGCAA...AGAGCCCTAAAAGTCTTAACT / GTTCTGCGCAACTTTCGACAACGTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14480 |
C. elegans |
set-11(n4488) II. Show Description
Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9.
|
|
| MT14525 |
C. elegans |
mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14531 |
C. elegans |
prg-2(nDf57) IV. Show Description
Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
|
|
| MT14588 |
C. elegans |
mir-234(n4520) II. Show Description
Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14615 |
C. elegans |
set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes).
|
|
| MT14661 |
C. elegans |
mir-265(n4534) IV. Show Description
Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14662 |
C. elegans |
mir-230(n4535) X. Show Description
Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14666 |
C. elegans |
egl-6(n4537) X. Show Description
2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.
|
|
| MT14673 |
C. elegans |
mir-359(n4540) X. Show Description
Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14678 |
C. elegans |
lgc-40(n4545) X. Show Description
1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
|
|
