Search Strains

Superficially WT.

irEx540 [ceh-51(+) + unc-119::CFP + rol-6(su1006)]. Throws arrested ceh-51(-) larvae, rescued animals expressing unc-119::CFP, and some unc-119::CFP-expressing larvae that are not rescued. Heterozygous mutant strain originally obtained from Shohei Mitani.

irIs25 [elt-2::NLS::GFP::lacZ + rol-6(su1006)] V.

mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

oxSi1091 [mex-5p::Cas9 (+ smu-2 introns)::tbb-2 3'UTR + Cbr-unc-119(+)] II. Slightly sick at 25, mantain at 20C. Cas9 expression in the germline. oxTi553 [eft-3p::tdTomato::H2B] V. Broad nuclear tdTomato expression. Reference: Malaiwong N, et al. G3 (Bethesda). 2023 May 2;13(5):jkad041. doi: 10.1093/g3journal/jkad041. PMID: 36805659.

syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirEx96 [flp-22p::CRE + unc-122p::mCherry]. Pick animals with red fluorescence in coelomocytes to maintain the array. SMD-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirIs37 [acr-5p::CRE + myo-2p::mCherry]. Superficially wild-type. CRE expression is driven predominantly in B-type motor neurons; CRE activity has also been observed in a few other cells. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirIs42 [F49H12.4p::CRE + myo-2p::mCherry]. Superficially wild-type. Primarily PVD-specific CRE driver; CRE activity was observed predominantly in PVD neurons with some additional recombination in a few tail neurons and possibly FLP neuron. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirIs71 [nlp-12p::CRE + myo-2p::mCherry]. DVA-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain.

Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.

Egg laying defective. Retains late stage eggs. Odr-see 1998 ECWM #71.

Variable egg laying defective. Abnormal vulva. Males mate.

Egg-laying defective. Retains late stage eggs. Semi-dominant. Males mate successfully. Egg-laying serotinin sensitive and imipramine resistant.

Egg laying defective. Retains late stage eggs.

nEx1039 contains [ced-10p::GFP::ced-10 + unc-76(+)]. Maintain at 20 C. Described in Lunquist et al., Development 128, 4475-4488 (2001).

Heterozygotes are semi-Dpy. Throws DpyLins and DTC-defective progeny.

Defects in engulfment, persistent cell coprses observed in embyros, larvae, and adult hermaphrodite gonads. Distal tip cell migration defects.

nIs106 [lin-11::GFP + lin-15(+)] X. Egl, Him. lin-11::GFP expressed in vulva, head neurons, VC neurons. n3376 enhances ced-3(n2427). Reference: (2007) Genetics 175(4)::1719-33.

Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.

nIs133 [pkd-2::GFP]. Reference: Schwartz HT & Horvitz HR (2007) Genes Dev 21(23):3181-94.

Egg laying defective. Most progeny released, but released late (lima bean or later). Males mate poorly.

Egg laying defective. Retains late stage eggs. Temperature sensitive.

Egg laying defective. Retains late stage eggs.

Egg laying defective. Retains late stage eggs. Partially temperature sensitive. Semidominant.

Egl. Reference: Genetics (1983) 104:619-47.

Egg laying defective. Retains late stage eggs. Slow and Floppy; Long.

Egg laying defective. Retains late stage eggs. partially ts

Egg laying defective. Retains late stage eggs. Temperature sensitive->non or weakly egl at 15C

Egg laying defective. Retains late stage eggs. Partially temperature sensitive.

Egg laying defective. Retains late stage eggs. Males mate. Weak kinker. Semidominant.

Egg laying defective. Retains late stage eggs. Semidominant.

Heterozygotes are WT and GFP+ and segregate WT, Dpy GFP+, and Sterile GFP-. n3630 predicted to cause W2132Amber.

Egg laying defective. Retains late stage eggs. Semidominant. Temperature sensitive-non or weakly Egl at 15C. Males mate.

Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.

Reference: Ceol CJ, Horvitz HR. Dev Cell. 2004 Apr;6(4):563-76.

Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.